ID: 1075183464

View in Genome Browser
Species Human (GRCh38)
Location 10:120233204-120233226
Sequence ACTCACCAGCATCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075183464_1075183473 28 Left 1075183464 10:120233204-120233226 CCCATCCTTGGATGCTGGTGAGT No data
Right 1075183473 10:120233255-120233277 CCTTTATCTATGCTCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075183464 Original CRISPR ACTCACCAGCATCCAAGGAT GGG (reversed) Intergenic
No off target data available for this crispr