ID: 1075187598

View in Genome Browser
Species Human (GRCh38)
Location 10:120277033-120277055
Sequence TGTCCTTTGAAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075187594_1075187598 3 Left 1075187594 10:120277007-120277029 CCATGCAGCCATAAAGAAAAAGA No data
Right 1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG No data
1075187595_1075187598 -5 Left 1075187595 10:120277015-120277037 CCATAAAGAAAAAGATCATGTCC No data
Right 1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075187598 Original CRISPR TGTCCTTTGAAGGACATGGA TGG Intergenic
No off target data available for this crispr