ID: 1075188296

View in Genome Browser
Species Human (GRCh38)
Location 10:120282935-120282957
Sequence GGGTCCCTATGGTGCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075188291_1075188296 4 Left 1075188291 10:120282908-120282930 CCTTGCTTAAGGATGTTGTTATA No data
Right 1075188296 10:120282935-120282957 GGGTCCCTATGGTGCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075188296 Original CRISPR GGGTCCCTATGGTGCCTCTG TGG Intergenic