ID: 1075190011

View in Genome Browser
Species Human (GRCh38)
Location 10:120298545-120298567
Sequence TGGAGCACTTAAAAGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075190006_1075190011 10 Left 1075190006 10:120298512-120298534 CCTAAATGGAAGTGATTGGTGTT No data
Right 1075190011 10:120298545-120298567 TGGAGCACTTAAAAGCTGGTAGG No data
1075190002_1075190011 27 Left 1075190002 10:120298495-120298517 CCTCCTGGCAGTTAGGTCCTAAA No data
Right 1075190011 10:120298545-120298567 TGGAGCACTTAAAAGCTGGTAGG No data
1075190003_1075190011 24 Left 1075190003 10:120298498-120298520 CCTGGCAGTTAGGTCCTAAATGG No data
Right 1075190011 10:120298545-120298567 TGGAGCACTTAAAAGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075190011 Original CRISPR TGGAGCACTTAAAAGCTGGT AGG Intergenic
No off target data available for this crispr