ID: 1075199201

View in Genome Browser
Species Human (GRCh38)
Location 10:120388069-120388091
Sequence CAGGCTAAGGACTCAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075199201_1075199206 13 Left 1075199201 10:120388069-120388091 CCAGGAACTGAGTCCTTAGCCTG No data
Right 1075199206 10:120388105-120388127 AACTCAGGACAATTAGTGTTAGG No data
1075199201_1075199205 -2 Left 1075199201 10:120388069-120388091 CCAGGAACTGAGTCCTTAGCCTG No data
Right 1075199205 10:120388090-120388112 TGTGGAGTCTGTGCTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075199201 Original CRISPR CAGGCTAAGGACTCAGTTCC TGG (reversed) Intergenic
No off target data available for this crispr