ID: 1075201132

View in Genome Browser
Species Human (GRCh38)
Location 10:120405151-120405173
Sequence CTGGAGGCCAGCACTTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075201132_1075201138 9 Left 1075201132 10:120405151-120405173 CCTCCAGAAGTGCTGGCCTCCAG No data
Right 1075201138 10:120405183-120405205 TGCCACCCTGACTCTTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075201132 Original CRISPR CTGGAGGCCAGCACTTCTGG AGG (reversed) Intergenic
No off target data available for this crispr