ID: 1075203428

View in Genome Browser
Species Human (GRCh38)
Location 10:120425749-120425771
Sequence GGGCTAAGTCAACCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075203428_1075203436 20 Left 1075203428 10:120425749-120425771 CCTGCCTTTGGTTGACTTAGCCC No data
Right 1075203436 10:120425792-120425814 GATTAAAGATATGTGATCTGGGG No data
1075203428_1075203434 18 Left 1075203428 10:120425749-120425771 CCTGCCTTTGGTTGACTTAGCCC No data
Right 1075203434 10:120425790-120425812 AAGATTAAAGATATGTGATCTGG No data
1075203428_1075203437 21 Left 1075203428 10:120425749-120425771 CCTGCCTTTGGTTGACTTAGCCC No data
Right 1075203437 10:120425793-120425815 ATTAAAGATATGTGATCTGGGGG No data
1075203428_1075203431 -8 Left 1075203428 10:120425749-120425771 CCTGCCTTTGGTTGACTTAGCCC No data
Right 1075203431 10:120425764-120425786 CTTAGCCCAAAGGAGCAAGTAGG No data
1075203428_1075203435 19 Left 1075203428 10:120425749-120425771 CCTGCCTTTGGTTGACTTAGCCC No data
Right 1075203435 10:120425791-120425813 AGATTAAAGATATGTGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075203428 Original CRISPR GGGCTAAGTCAACCAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr