ID: 1075206860

View in Genome Browser
Species Human (GRCh38)
Location 10:120456449-120456471
Sequence GTTCAGCAGCCCCAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075206855_1075206860 22 Left 1075206855 10:120456404-120456426 CCGGCCAGGCCAGGGACGGTGGC No data
Right 1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG No data
1075206857_1075206860 18 Left 1075206857 10:120456408-120456430 CCAGGCCAGGGACGGTGGCAGGA No data
Right 1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG No data
1075206852_1075206860 29 Left 1075206852 10:120456397-120456419 CCACACACCGGCCAGGCCAGGGA No data
Right 1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG No data
1075206858_1075206860 13 Left 1075206858 10:120456413-120456435 CCAGGGACGGTGGCAGGAGCTTT No data
Right 1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG No data
1075206850_1075206860 30 Left 1075206850 10:120456396-120456418 CCCACACACCGGCCAGGCCAGGG No data
Right 1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075206860 Original CRISPR GTTCAGCAGCCCCAAGCTGC TGG Intergenic
No off target data available for this crispr