ID: 1075207923

View in Genome Browser
Species Human (GRCh38)
Location 10:120462746-120462768
Sequence CAGAATCTGCATTTTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075207918_1075207923 18 Left 1075207918 10:120462705-120462727 CCAGGTCAGGCTAACTGAATTAA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG No data
1075207917_1075207923 19 Left 1075207917 10:120462704-120462726 CCCAGGTCAGGCTAACTGAATTA 0: 1
1: 0
2: 2
3: 11
4: 126
Right 1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075207923 Original CRISPR CAGAATCTGCATTTTGAACA GGG Intronic
No off target data available for this crispr