ID: 1075216303

View in Genome Browser
Species Human (GRCh38)
Location 10:120539231-120539253
Sequence CAGCAGTGGCTCTAGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 311}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216303_1075216312 -7 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216312 10:120539247-120539269 ACTGCTGTTAGAGGCAGAAGGGG No data
1075216303_1075216311 -8 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216311 10:120539246-120539268 CACTGCTGTTAGAGGCAGAAGGG No data
1075216303_1075216313 -2 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216303_1075216317 24 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216317 10:120539278-120539300 TGGTCACAGGTCAGGTCACTTGG No data
1075216303_1075216310 -9 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216310 10:120539245-120539267 CCACTGCTGTTAGAGGCAGAAGG No data
1075216303_1075216315 11 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216315 10:120539265-120539287 AGGGGTCAGGATATGGTCACAGG No data
1075216303_1075216314 4 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216303_1075216316 16 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216316 10:120539270-120539292 TCAGGATATGGTCACAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216303 Original CRISPR CAGCAGTGGCTCTAGGGGAC GGG (reversed) Intronic
900102990 1:970775-970797 CAGGAGTGCCTCTGGGGGCCCGG - Intronic
901823523 1:11845929-11845951 CAGCAGAGACCCCAGGGGACAGG + Exonic
902849360 1:19141453-19141475 CAGCAGGGCCTCCAGGGGAGAGG + Exonic
903590694 1:24453636-24453658 CATCAGTGGCTCTGGGGAGCTGG + Intronic
904008728 1:27377946-27377968 CAGCAGGGGCTCTAGGGAGACGG + Intergenic
905751905 1:40472637-40472659 CAACAGTGGGCCCAGGGGACCGG - Intergenic
906605137 1:47164042-47164064 CAGCAGTGGCTGGAGGAGGCAGG - Intergenic
907299340 1:53476796-53476818 CAGCAGAGGGTCAAGGGGCCTGG + Intergenic
907520862 1:55022468-55022490 CAGCAGTGTCCTTGGGGGACAGG - Intergenic
908828694 1:68158087-68158109 CAGCAGAGGGTCTAGGGCAGTGG + Intronic
914441270 1:147709508-147709530 CAAGAGTGGGTCCAGGGGACCGG + Intergenic
916853268 1:168725508-168725530 CAGCACAGGCTGTAGGGCACTGG - Intronic
917207899 1:172596994-172597016 CAGCAGTGAGGCTAGGGGAGGGG - Intronic
918398091 1:184136316-184136338 CAGCAGTGAGGCTAGGGGAGGGG - Intergenic
919568586 1:199219175-199219197 CCCCAGTGGCTCCAGGGGAATGG - Intergenic
919829745 1:201531965-201531987 CAGCAGCTGATCTAGGGAACAGG + Intergenic
920815592 1:209328726-209328748 GAGCAGTGGATCTTGGTGACAGG + Intergenic
921079438 1:211726738-211726760 CAGCACTGGGAATAGGGGACAGG + Intergenic
921776860 1:219111689-219111711 CCCCAGTGGCTCCAGGGGAATGG + Intergenic
922383856 1:225061220-225061242 CAGCAGTGAGGCTAGGGGAGGGG - Intronic
922715121 1:227866071-227866093 TAACAGTGGCTCAAGGGGAGGGG - Intergenic
922801272 1:228365773-228365795 CAGCTGTCGCTCTCAGGGACAGG - Intronic
1064131166 10:12711249-12711271 CAGCAGTGGTCATAGGGGACTGG + Intronic
1065353916 10:24820753-24820775 CAGCAGTGGATCATGGAGACAGG + Intergenic
1065809403 10:29427618-29427640 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1066175121 10:32895361-32895383 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1068214681 10:53968286-53968308 CAGCAGTGAGGCTAGGGGAGGGG + Intronic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1070543195 10:77432090-77432112 CAGCTGTGGCTCTGGGAGCCTGG - Intronic
1070830294 10:79413984-79414006 CAACACTGGCTGTAGAGGACTGG - Intronic
1070998376 10:80806789-80806811 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1071663589 10:87530909-87530931 CAGCAGTGAGGCTAGGGGAAGGG - Intronic
1071736119 10:88303069-88303091 CCACAGTGGCTCCAGGGGAATGG + Intronic
1071999192 10:91177612-91177634 CAGCAGTGAGGCTGGGGGACGGG - Intronic
1072410446 10:95197294-95197316 CAACAGTGGGCCCAGGGGACCGG + Intronic
1072541831 10:96404146-96404168 CAACAGTGGGCCCAGGGGACCGG - Intronic
1073106244 10:101033633-101033655 CAACAGTGGGCCCAGGGGACCGG + Intronic
1073151040 10:101311590-101311612 CAGAAGTGTCTCTAGGAGGCTGG - Intergenic
1073352972 10:102832791-102832813 CAGTAGTGGCTCTGGGGCCCAGG + Intronic
1073404722 10:103287192-103287214 CAGCATTGCCCCTAGGTGACTGG - Intronic
1073459737 10:103659797-103659819 CACCAGTGGCTCCAGAGAACAGG - Intronic
1075216303 10:120539231-120539253 CAGCAGTGGCTCTAGGGGACGGG - Intronic
1075391787 10:122097541-122097563 CTGAAGTGGCCCCAGGGGACGGG + Intronic
1075410915 10:122227434-122227456 CAGTAGTGGCACCAGGTGACAGG + Intronic
1076569200 10:131421178-131421200 CAGCAGTGCCTGTAGGGGACAGG - Intergenic
1076941268 10:133610885-133610907 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1076941288 10:133611060-133611082 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1077348574 11:2077148-2077170 CAGCAGTGGCTCATGGGGGCTGG - Intergenic
1077585372 11:3447526-3447548 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1077586281 11:3456053-3456075 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1077597443 11:3546255-3546277 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1077603868 11:3593759-3593781 CAACAGTGGGCCTAGGGGACCGG + Intergenic
1078101290 11:8331840-8331862 CAGCAGAGGCTGGAGGGCACAGG + Intergenic
1079353985 11:19714900-19714922 CAGCAGGGACTTTTGGGGACAGG + Intronic
1079851513 11:25541605-25541627 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1080715389 11:34795247-34795269 CAGCAGTTGCCCTGGGGGACAGG + Intergenic
1081019824 11:37931467-37931489 CAACAGTGGGCCCAGGGGACTGG - Intergenic
1081072386 11:38627844-38627866 CAGGAGTGGTTCTAGAGGAACGG + Intergenic
1081483244 11:43507925-43507947 CAGCAGTGGTTCTGGGGCACAGG - Intergenic
1082716306 11:56618418-56618440 GAACAGTGGCCCCAGGGGACCGG + Intergenic
1084242278 11:67830085-67830107 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1084259764 11:67968348-67968370 AAACAGTGGGCCTAGGGGACCGG + Intergenic
1085046363 11:73356044-73356066 CATCAGGGTCCCTAGGGGACAGG + Intronic
1086174288 11:83871304-83871326 CAGCAGTGACTCTATGGTAGAGG + Intronic
1088858451 11:113777934-113777956 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1089512415 11:119008202-119008224 CAACGGTGGGTCCAGGGGACTGG + Intronic
1089695748 11:120215384-120215406 GCGCAGTTGCTCTAGGGGAGGGG + Intronic
1089990241 11:122852616-122852638 AAGGAGTGGCTCTCGGGGAGGGG + Intronic
1090949983 11:131464684-131464706 CAGCAGTGCCCCGAGGGGCCAGG + Intronic
1092323951 12:7509584-7509606 CAGCAGTGGCTGTAGAAGAGCGG + Intergenic
1092405740 12:8221085-8221107 CAACACTGGGTCCAGGGGACCGG - Intergenic
1092412519 12:8264784-8264806 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1092431065 12:8409318-8409340 CAACAGTGGACCTAGGGGACCGG + Intergenic
1092632296 12:10395067-10395089 CAACAGTGGGCCCAGGGGACTGG - Intronic
1097186223 12:57197959-57197981 CAGCAGAGGCTCTAGGAGAGGGG - Intronic
1099473020 12:83074513-83074535 CTGCAGCTGCTCTAGGGGATGGG + Intronic
1100355108 12:93821446-93821468 CAACAGAGGGACTAGGGGACTGG - Intronic
1101759195 12:107645319-107645341 CAGCAGTGGTTCTCAGAGACAGG - Intronic
1101823621 12:108203242-108203264 CAGCAGTGGCTCTGCTGGACTGG + Intronic
1102157988 12:110745656-110745678 CACAAGTGGCCCCAGGGGACTGG - Intergenic
1103851388 12:123935915-123935937 GAGAAGTGGCTCCAGGTGACTGG - Exonic
1104779080 12:131408246-131408268 CAGCAGTTCCTCTAAGAGACTGG - Intergenic
1104989098 12:132615043-132615065 CAGCAGAAGCTCTCGGGGGCTGG + Intergenic
1105055552 12:133095572-133095594 CAACAGTGGGCCCAGGGGACCGG + Intronic
1107149244 13:37092403-37092425 CAGGAGTGGCTGCAGGGGAAGGG + Intergenic
1109932561 13:69234998-69235020 ATGCAGTGGCTCTAGGGCAGGGG + Intergenic
1112367183 13:98765229-98765251 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1112735243 13:102408861-102408883 CAGGAGTGGATCTAGGGAAGGGG - Intergenic
1114307498 14:21437194-21437216 CTGCAGTGGCTGTGGGGGGCCGG + Intronic
1114603180 14:23972672-23972694 CAACAGTGAGTCCAGGGGACCGG + Intronic
1114608160 14:24015153-24015175 CAACAGTGGGCCGAGGGGACCGG + Intergenic
1117335352 14:54752705-54752727 CAACAGTGGGCCCAGGGGACCGG + Intronic
1117814986 14:59588174-59588196 CAGCAGTGAGTCTGGGGGGCAGG - Intergenic
1118596588 14:67440427-67440449 CAGCAGTGGATCAAGGTGAGTGG - Intergenic
1121527132 14:94627020-94627042 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1122032116 14:98919778-98919800 CAGCAGAGGCACAAGAGGACTGG + Intergenic
1122303861 14:100749069-100749091 CAGCAGTGGCTGTAGATGATTGG - Intergenic
1123148298 14:106155873-106155895 CACCAGTGCCCCTAGGGTACTGG - Intergenic
1123821199 15:24031921-24031943 AAGCAGTGGCTCAAGGGCCCTGG + Intergenic
1124100505 15:26688684-26688706 CTGCATTGGTTCTATGGGACAGG + Intronic
1124461292 15:29894666-29894688 CACCAGTGGCTCTACTGGTCTGG + Intronic
1125562258 15:40644052-40644074 CAACAGTGGGCCCAGGGGACCGG + Intronic
1127386993 15:58474882-58474904 CAGCAGTTGCTCTCTGGGATGGG - Intronic
1127614336 15:60668591-60668613 CACCAGTGCCTCTAGAGAACAGG - Intronic
1131194755 15:90346661-90346683 CAACAGTGGGCCCAGGGGACCGG + Intergenic
1131442074 15:92466953-92466975 CAGCAGAGGATCTCGGGGCCGGG - Exonic
1131946618 15:97629202-97629224 CAACAGTGGGCCCAGGGGACCGG + Intergenic
1132603228 16:783081-783103 CAGCCTTTGCTCTAGGGGAAGGG - Intronic
1132831711 16:1931735-1931757 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1132951383 16:2564278-2564300 GAGCAGTGGCTCTCGAGGCCAGG - Intronic
1132962967 16:2635892-2635914 GAGCAGTGGCTCTCGAGGCCAGG + Intergenic
1133767777 16:8849749-8849771 CAGGAGGGGCTCGAGGGGCCTGG - Intergenic
1136101967 16:28003328-28003350 CAGCAGGGACTGCAGGGGACGGG + Intronic
1136681909 16:31971768-31971790 CACCAGTGCCCCTAGGGTACTGG + Intergenic
1136887570 16:33940582-33940604 CACCAGTGCCCCTAGGGTACTGG - Intergenic
1137360826 16:47813678-47813700 CAGCAGTGAGGCTAGGGGAGGGG - Intergenic
1137674744 16:50298755-50298777 CAGAAGTGGCTCCTGGTGACTGG + Intronic
1138596933 16:58034152-58034174 CACCTGTGACTCTAGGTGACAGG + Intronic
1138738557 16:59280542-59280564 CAGAAGTGGCTCTTGGGTTCTGG - Intergenic
1139836386 16:69842057-69842079 CAGCAGTAGCTCCAGAGAACCGG + Exonic
1141673033 16:85502836-85502858 CAGCAGTGGCCCTGGGGACCAGG + Intergenic
1141710440 16:85695775-85695797 CAGCAGTGGGTCTGATGGACTGG + Intronic
1142131076 16:88431735-88431757 CAGCTGTGGCTCGAGGGAACCGG - Exonic
1142225310 16:88874265-88874287 GATCAAAGGCTCTAGGGGACAGG - Intergenic
1203084880 16_KI270728v1_random:1177256-1177278 CACCAGTGCCCCTAGGGTACTGG + Intergenic
1143668182 17:8376756-8376778 CCGCGGTGCCTCTAGGGGGCGGG - Intronic
1143850800 17:9810399-9810421 CACCACTGGCTATAGGGCACAGG + Intronic
1144756978 17:17685815-17685837 CAGCTGTGGCTGGAGGGGACAGG - Intronic
1145363368 17:22230499-22230521 CAACAGTGGGTCCAGGAGACCGG - Intergenic
1145937840 17:28725732-28725754 CCGCAGTGGCCCCAGGGGAGGGG - Intronic
1147967313 17:44200106-44200128 CAGCATTTGCTCCAGGGGGCGGG + Intronic
1148029125 17:44608026-44608048 CAGCAGGAGCTCTTGGGGGCAGG + Intergenic
1150487113 17:65551462-65551484 CAGCAGGGGTGCCAGGGGACCGG + Intronic
1151076083 17:71274215-71274237 AGGCTGTGGCTTTAGGGGACGGG - Intergenic
1151341403 17:73473316-73473338 CAGGAGTGGATGAAGGGGACCGG + Intronic
1151457986 17:74238034-74238056 CAGCAGAGGCTACAGAGGACAGG + Intronic
1152326920 17:79646978-79647000 CAGCAGTGGAGCCAGGGGACAGG + Intergenic
1152586783 17:81192856-81192878 CAGGACTGGCTCTCGGGGGCCGG + Intronic
1153399512 18:4667488-4667510 ATGCTGTGGCTCTAGGGGGCTGG - Intergenic
1156022719 18:32618225-32618247 CAGCATTTGCTCTAGGGCAGTGG - Intergenic
1157500136 18:48184680-48184702 GAGAAGTGGCTCTGGGGGAAAGG + Intronic
1157607559 18:48935471-48935493 CTGCAGTGGCCGTAGGTGACTGG - Intronic
1158396035 18:57078843-57078865 CAGCAGTGGGTGTCGGGGAGGGG + Intergenic
1159606518 18:70480025-70480047 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1160270011 18:77375189-77375211 CAGCAGTGTCTCTCGGCGAAGGG + Intergenic
1160588871 18:79928713-79928735 CTGCAGTGGCACTGGGGGAGAGG - Intronic
1160808565 19:1003158-1003180 CAGCAGCGTCTCCAGGGGGCTGG - Exonic
1161167820 19:2797822-2797844 CAGCGGTGGCTTTATGGAACCGG - Intronic
1161611642 19:5246477-5246499 CAGCAGTGGCTTCAGGGAGCAGG + Intronic
1161866679 19:6837430-6837452 CAGCAGAGGCTGGAGTGGACAGG - Intronic
1163485167 19:17581126-17581148 CAGCAATGGCTTCAGGGGACGGG - Intronic
1164055687 19:21620311-21620333 CAACAGTGGACCCAGGGGACCGG + Intergenic
1164536100 19:29087592-29087614 CAGGAGTGGCTCCTGAGGACAGG + Intergenic
1164593606 19:29519602-29519624 CAGAAGTGGCATTGGGGGACAGG - Intergenic
1164905086 19:31960631-31960653 CAGCGGTGGCTCTAGCAGCCGGG + Intergenic
1166172134 19:41036146-41036168 CAACAGTGGGCCCAGGGGACTGG + Intergenic
1167814699 19:51869574-51869596 GAACAGTGGCCCCAGGGGACCGG - Intronic
1168235496 19:55060573-55060595 CAACAGTGGGCCCAGGGGACCGG - Intronic
925265514 2:2563827-2563849 CTGCAGAGGCTCTTGGGGGCAGG + Intergenic
927188754 2:20501269-20501291 CAACAGTGGGCCCAGGGGACCGG + Intergenic
928202329 2:29256157-29256179 CAAGAGTGGTTCCAGGGGACAGG + Intronic
929711479 2:44271221-44271243 GAGCAGTGGCTCAAGGGCCCCGG + Intergenic
932048533 2:68375723-68375745 CAGCAGGGTCTCTTGGGAACTGG + Intronic
933555357 2:83824085-83824107 CCCCAGTGACTCTAGGGGAATGG - Intergenic
934592452 2:95568062-95568084 CAACAGTGGGTCCAGGGGACCGG - Intergenic
938821797 2:134967799-134967821 CAACAGTGGGCCTAGGGGACCGG - Intronic
940558383 2:155262270-155262292 CAGCAGTGCTTCCAGGGGTCGGG - Intergenic
940797494 2:158096059-158096081 CATCAGTGCCTCTAGTGGCCTGG - Intronic
941696867 2:168562345-168562367 CAACAGTGGGCCCAGGGGACCGG + Intronic
943786037 2:191880185-191880207 GAGCAGTGGCTGCTGGGGACAGG + Intergenic
943833716 2:192492214-192492236 CAGGAGTGGCTTTAGAGGAACGG + Intergenic
944139921 2:196444826-196444848 CAGTGGTGGCTCTGGGGGTCAGG + Intronic
944410589 2:199438675-199438697 CAGCAGGGCGTCTAGGTGACAGG + Intronic
944445376 2:199783650-199783672 CAGGAGAGGCTGTATGGGACAGG - Intronic
945005125 2:205397026-205397048 CAGTAGTGGCAGTAGTGGACCGG - Intronic
945677741 2:212876117-212876139 CAGCAGTGAGGCTAGGGGAGGGG + Intergenic
946011961 2:216572569-216572591 CATCAGTGGGTCAAGAGGACAGG - Intronic
946158700 2:217823061-217823083 CAGCAGGGGCTGCAGGGGCCTGG - Intronic
947516590 2:230810703-230810725 CAGCACTGGCCAGAGGGGACGGG + Intronic
948809891 2:240469051-240469073 CAGCGGGGCCCCTAGGGGACAGG + Intergenic
1168789024 20:563640-563662 CCTCAGTGGCTCTAGGGGGAAGG - Intergenic
1169208161 20:3751499-3751521 CAGCAGGGCCTCTGCGGGACAGG - Exonic
1171272804 20:23829422-23829444 CAACAGTGGGCCCAGGGGACCGG + Intergenic
1172921360 20:38485328-38485350 CCACAGTGCCTCTAGGTGACAGG + Intronic
1174911437 20:54612259-54612281 CAGCACTGGCTCACGGGGGCAGG - Intronic
1175640777 20:60628495-60628517 CAGCAGTGGCTTTTGCTGACAGG - Intergenic
1176142019 20:63548998-63549020 CAGCAGGGGCCCTGGGAGACTGG + Intronic
1177180435 21:17739097-17739119 CAGCAGTGGCACTAGGAAAGGGG - Intergenic
1179464226 21:41561107-41561129 CAGCAGTGGCTCAGGGGCCCAGG + Intergenic
1179930863 21:44570015-44570037 CAGCAGTGTCTCTCTGAGACTGG - Intronic
1180000141 21:44991794-44991816 CAGCAGGGGCTCCAGGGTCCGGG + Intergenic
1182360245 22:29742279-29742301 CAGCAGTGGCTCCAGCTGACTGG - Intronic
1182441848 22:30369341-30369363 CAGCTCTGGCTCTGGGGAACTGG - Intronic
1182471674 22:30552629-30552651 CGGCAGTGGCTCTAAGGGATTGG + Intergenic
1183454813 22:37916821-37916843 CAGGAGTGGCTCCAGCTGACTGG - Intronic
1184381037 22:44145077-44145099 CTGCGGAGGCTCTGGGGGACAGG + Intronic
1184403406 22:44286693-44286715 CAGATGTGGCTCTGGGTGACAGG - Intronic
1185030990 22:48442830-48442852 CAGCAGGAGCTCCCGGGGACGGG + Intergenic
1185089696 22:48758950-48758972 CAGCAGTGTCACTAGGGCCCAGG + Intronic
950441721 3:13014587-13014609 CAGCCCTGGCTCTTGGGGGCAGG - Intronic
954731409 3:52665734-52665756 CAGCAGTGGATGTAGGGGGCAGG - Intronic
955257174 3:57344091-57344113 CAACAGTGGGTCCAGGGGACCGG - Intronic
957987445 3:87590025-87590047 CATCAGTGGATCTAGGAGCCTGG + Intergenic
959433525 3:106284658-106284680 CCGCAGTGGCTCCTGGGGAAAGG + Intergenic
959687148 3:109159864-109159886 CAGCAGTCACTCTAGGGGCTGGG - Intergenic
959981101 3:112518733-112518755 CACCAATGGCTCTTGGGTACAGG + Intergenic
961155988 3:124680166-124680188 CTGCCGTGGCTCCAGGAGACAGG - Intronic
961285540 3:125799349-125799371 CAACAGTGGGCCCAGGGGACCGG + Intergenic
961472383 3:127124061-127124083 CAGCAGTGGTTCCAATGGACTGG + Intergenic
961514822 3:127425966-127425988 CAGCTGGGGCTCTAGGGAGCTGG + Intergenic
961617522 3:128194407-128194429 CAGCAGTGGCTGGATGGGACTGG + Intronic
961674335 3:128555600-128555622 CAGCTGTGGCATTCGGGGACGGG + Intergenic
961875011 3:130015675-130015697 CAACAGTGGGCCTAGGGGACCGG + Intergenic
961890083 3:130123436-130123458 CAACAGTGGGTCCAGGGGACCGG + Intergenic
963216256 3:142752145-142752167 CAACAATGGGTCCAGGGGACTGG + Intronic
964379789 3:156086768-156086790 CAGAAGTGGCTCTTGTGGTCTGG + Intronic
966044737 3:175534194-175534216 CAGGAGTGGTTCTAGAGGAACGG - Intronic
966733633 3:183170885-183170907 CAACAGTGAGTCCAGGGGACCGG - Intergenic
968987361 4:3883450-3883472 CAACAGTGGGCTTAGGGGACCGG + Intergenic
969000558 4:3977424-3977446 CAACAGTGGGTCCAGGGGACAGG + Intergenic
969001481 4:3986004-3986026 CAACAGTGGGCCCAGGGGACCGG + Intergenic
969012187 4:4075193-4075215 CAGCAGTGGGCCCAGGGTACCGG - Intergenic
969018324 4:4120409-4120431 CAACAATGGACCTAGGGGACCGG + Intergenic
969023005 4:4150610-4150632 CAACAGTGAGCCTAGGGGACCGG + Intergenic
969161521 4:5263360-5263382 CTGCTGTGGCTTTAGGAGACTGG - Intronic
969735662 4:8988304-8988326 CAACAGTTGGCCTAGGGGACCGG - Intergenic
969752540 4:9122687-9122709 CAACAGTGGGTCCAGGGGACCGG - Intergenic
969753456 4:9131245-9131267 CAACAGTGGGTCCAGGGGACTGG - Intergenic
969760384 4:9176883-9176905 CAACAGTGGGTCCAGGTGACCGG + Intergenic
969794878 4:9519764-9519786 CAACAGTAGACCTAGGGGACCGG - Intergenic
969801268 4:9567412-9567434 CAACAGTGGGCCCAGGGGACCGG + Intergenic
971255947 4:25013419-25013441 GACAAGTGGCTCTAGTGGACGGG + Intronic
971458021 4:26861668-26861690 CAGCAGGGTCTGCAGGGGACTGG + Intronic
972846871 4:43001735-43001757 CAACAGTGGGTCCAGGGGACCGG + Intronic
977296237 4:95212717-95212739 CAGCAGTGGCTCCAGGGGAGAGG - Intronic
977696603 4:99972430-99972452 ATGCTGTAGCTCTAGGGGACTGG - Intergenic
978455198 4:108881326-108881348 CAGCTGTTGCTCTCGGGGAATGG - Intronic
978758070 4:112325688-112325710 CAGCAGTGGCTCATGAAGACTGG - Intronic
981500674 4:145448173-145448195 TAGCAGTGGCTCTGGGGACCTGG + Intergenic
982337544 4:154257288-154257310 CAGCTATGGTTCTAGGGTACCGG + Intronic
983212817 4:164976262-164976284 CAACAGTGGGCCCAGGGGACCGG - Intronic
985494515 5:196878-196900 CAACAGTGGGCCCAGGGGACCGG + Exonic
986615575 5:9613810-9613832 GAGCAGAGGCTCTAGGGGGTTGG - Intergenic
988062235 5:26186085-26186107 CAACAGTGGGCCCAGGGGACTGG + Intergenic
988200764 5:28066172-28066194 CCCCAGTGGCTCAAGGGGAATGG + Intergenic
988721207 5:33881063-33881085 CAGCTGAGACTCTAGGGGCCAGG + Intronic
989296063 5:39828154-39828176 CAACAGTGGGCCCAGGGGACCGG + Intergenic
989844887 5:46129374-46129396 CAGCAGTGGGACTGGGGGAGGGG + Intergenic
990239578 5:53803206-53803228 CAGCAGTGAGGCTAGGGGAGGGG + Intergenic
990619805 5:57547542-57547564 CAACAGTGGACCCAGGGGACCGG - Intergenic
990993882 5:61711954-61711976 CGGAAGTGCCTCTAGGGCACAGG + Intronic
993883883 5:93394766-93394788 CAGCAGTGGCTATGGCGGATGGG + Intergenic
994404653 5:99329295-99329317 CAACAGTGGGCCCAGGGGACTGG - Intergenic
994503263 5:100606926-100606948 CAACAGTGGGCCCAGGGGACCGG - Intergenic
994969667 5:106719448-106719470 CAGCAGTGAGGCTAGGGGAGGGG - Intergenic
996356112 5:122598232-122598254 CAGCAGTGAGGCTAGGGGAGGGG - Intergenic
998159853 5:139807240-139807262 GAGCATTGGCTCTGGGGCACAGG - Intronic
999216858 5:149942576-149942598 GAGCAGTGGGCCCAGGGGACTGG + Intronic
999560600 5:152797390-152797412 CAACAGTGGGCCCAGGGGACCGG + Intergenic
1000107058 5:158069763-158069785 CAGCAGTGAACCAAGGGGACTGG - Intergenic
1000527079 5:162371002-162371024 CAACAGTGGGCCCAGGGGACTGG - Intergenic
1002060067 5:176620739-176620761 CAGCCCTGGCTCTGGGGGGCGGG + Exonic
1002538972 5:179893691-179893713 CACCAGTGGCTGAAGGGGAAAGG + Intronic
1002650556 5:180689652-180689674 TAACAGTGGGCCTAGGGGACTGG + Intergenic
1002966499 6:1971204-1971226 CAGCAGTGGCTCTGGAGCAGAGG + Intronic
1003874589 6:10424474-10424496 CAGGAGTGGCGCTGGGGAACTGG - Intergenic
1004350018 6:14882723-14882745 CAGCAGTGGACCTGGGGGCCAGG + Intergenic
1004706207 6:18126144-18126166 GAGCAGTGGCTCAAGGGCCCTGG + Intergenic
1006801922 6:36765216-36765238 CCGCAGTGGCTCTGGGGGTGAGG - Intronic
1007328514 6:41083570-41083592 CAGCAATGACTCTAGGAGGCTGG - Intronic
1007747968 6:44054878-44054900 AAACAGTGGCTCGAGGGGGCAGG + Intergenic
1009193366 6:60655890-60655912 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1009193777 6:60660853-60660875 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1009229663 6:61046787-61046809 GGGCAGTGACTCTAGAGGACAGG - Intergenic
1009260504 6:61479977-61479999 CACCATTGGCTCTAGGGTCCAGG - Intergenic
1009540230 6:64945092-64945114 CAACAGTGGGCCCAGGGGACCGG - Intronic
1010888017 6:81268259-81268281 CACCAGTGCCTGTAGGGGAGTGG - Intergenic
1011081642 6:83496081-83496103 CAGCAGTGGGGCTGGGGGAGGGG + Intergenic
1011503195 6:88013302-88013324 CTCCAGTTGCTCTTGGGGACAGG - Intergenic
1011662818 6:89608958-89608980 CAGGAGGTGCTCTAGGGGAAAGG - Intronic
1012120535 6:95361310-95361332 CAACAGTGGGCCCAGGGGACCGG + Intergenic
1016177270 6:141096309-141096331 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1016214980 6:141588444-141588466 AGGCAGTGGCCCTGGGGGACTGG + Intergenic
1016599529 6:145842193-145842215 CTGAAGTGGGTCTAGGGGAATGG + Intergenic
1017723268 6:157259040-157259062 CCGCAGTGGCTCCAGGGTAATGG - Intergenic
1018015050 6:159704560-159704582 CAGCAGTGAGGCTAGGGGAGGGG + Intronic
1018060042 6:160083011-160083033 CAACAGTGGGCCCAGGGGACCGG + Intronic
1018216761 6:161535844-161535866 CTGCAGTGGCTTAAGGGGATGGG - Intronic
1018931818 6:168245065-168245087 CTGCAGAGGCTCTCGCGGACAGG + Intergenic
1019186645 6:170224407-170224429 CAGCAGCAGCTCTAGGGGCCAGG + Intergenic
1019326192 7:439482-439504 CACCAGGGGCTCTCGGGGGCTGG - Intergenic
1019326806 7:442527-442549 CAGATGTGGCTCTAGGTGAGGGG - Intergenic
1019650854 7:2157498-2157520 GAGCAGAGACTGTAGGGGACCGG - Intronic
1020310056 7:6860335-6860357 CAACAGTGGGCCTAGCGGACCGG + Intergenic
1021765552 7:23944407-23944429 CAGCAGTGGCAGTGGTGGACTGG - Intergenic
1022506495 7:30911265-30911287 GAGCCCTGGCTCTGGGGGACTGG + Intergenic
1022977959 7:35575812-35575834 CAGCAGAGCCTCAAGGGGAAGGG + Intergenic
1023993561 7:45145183-45145205 CAGCTGATGCTCTGGGGGACTGG + Intergenic
1024366117 7:48522245-48522267 CAGCAGTGGGTGCAGGTGACAGG - Intronic
1025075909 7:55942992-55943014 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1025937803 7:66051044-66051066 CAGCAGAGGCCCCAGGAGACAGG - Intergenic
1026188596 7:68103853-68103875 CAACAGTGGGCCCAGGGGACAGG + Intergenic
1026824695 7:73574112-73574134 CCGCTGTGGCTCTAGGGGAAGGG + Exonic
1029076808 7:97941117-97941139 CAACAGTGGGCCTAGGGGACCGG + Intergenic
1029453304 7:100654924-100654946 GAGCAGTGGCTTGAGGGGAGAGG + Intronic
1030009228 7:105149543-105149565 CAACAGTGGGCCCAGGGGACTGG - Intronic
1032024457 7:128430547-128430569 AAGCAGTGTCTCTTTGGGACGGG - Intergenic
1034692536 7:153025296-153025318 CACCATTGGCTCTAGTGAACTGG + Intergenic
1035931005 8:3779903-3779925 AAGCAGTGGATCTGGGAGACAGG - Intronic
1036240971 8:7080825-7080847 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1036253700 8:7187284-7187306 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1036261088 8:7240754-7240776 CAACAGTGGGCCTAGGGGACCGG + Intergenic
1036264010 8:7260629-7260651 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036265306 8:7268251-7268273 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036266607 8:7275873-7275895 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036267913 8:7283495-7283517 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036269217 8:7291117-7291139 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036270496 8:7298737-7298759 CAAAAGTGGGTCCAGGGGACCGG + Intergenic
1036297378 8:7548318-7548340 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1036298679 8:7555963-7555985 CAACAGTGGGTCCAGGGGACAGG - Intergenic
1036299984 8:7563613-7563635 CAACAGTGGGTCCAGGGGACAGG - Intergenic
1036301289 8:7571258-7571280 CAACAGTGGGTCCAGGGGACAGG - Intergenic
1036302588 8:7578907-7578929 CAACAGTGGGTCCAGGGGACAGG - Intergenic
1036313127 8:7699298-7699320 CAACAGTGGGCCTAGGGGACCGG + Intergenic
1036316050 8:7719168-7719190 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036317358 8:7726816-7726838 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036318666 8:7734464-7734486 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036319973 8:7742111-7742133 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036321282 8:7749759-7749781 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036322591 8:7757407-7757429 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036323897 8:7765055-7765077 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036325200 8:7772703-7772725 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036350854 8:8011607-8011629 CAAAAGTGGGTCCAGGGGACCGG - Intergenic
1036352143 8:8019251-8019273 CAACAGTGGGTCCAGGGGACAGG - Intergenic
1036353442 8:8026899-8026921 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1036363792 8:8100196-8100218 CAACAGTGGGCCCAGGGGACCGG + Intergenic
1036375753 8:8198081-8198103 CATCAGTGGGTCCAGGGGACCGG - Intergenic
1036376672 8:8206577-8206599 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1036846129 8:12172024-12172046 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1036852865 8:12216561-12216583 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036853777 8:12225062-12225084 CATCAGTGGGTCCAGGGGACCGG + Intergenic
1036867494 8:12414343-12414365 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1036874238 8:12459083-12459105 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1036875152 8:12467572-12467594 CATCAGTGGGTCCAGGGGACCGG + Intergenic
1036894763 8:12624984-12625006 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1037575434 8:20197846-20197868 AAGAAGTGGCCCTCGGGGACGGG - Intronic
1037778206 8:21849459-21849481 CAGCACTCGCTCTGGGTGACTGG - Intergenic
1038369776 8:26976958-26976980 GAGCAGTGGCTCTGGGGTATTGG + Intergenic
1038997795 8:32945275-32945297 CAGCAGTGGCATTAGTGGGCTGG + Intergenic
1039834512 8:41246002-41246024 CTGGAGTGCCTCTCGGGGACTGG + Intergenic
1040571975 8:48619479-48619501 GAGCAGTGGCTGTAGGGGAGAGG - Intergenic
1041589104 8:59556051-59556073 TCCCAGTGGCTCTAGGGGAAGGG - Intergenic
1041782856 8:61596407-61596429 CAGCAGTGGCTGCAGTGGGCAGG - Intronic
1044467791 8:92526639-92526661 CAGCAGTGGCAGCAGAGGACTGG - Intergenic
1044871650 8:96625809-96625831 CAGCATTGGCTCTTGAGGAAGGG + Intergenic
1047249838 8:123173787-123173809 CAGCTGTGGCTCTCTGGGAATGG + Intergenic
1048327120 8:133448401-133448423 CGGCAGGGACTCCAGGGGACAGG - Intergenic
1049164149 8:141116325-141116347 CAGCAGTGGCACAAGGAGGCTGG + Intergenic
1050540435 9:6664898-6664920 CCACAGTGGCTCAAGGGAACAGG + Intergenic
1050596950 9:7213592-7213614 GAGCATTGGCTCAAGGGGACAGG - Intergenic
1052469931 9:28881092-28881114 CAACAGTGGGCCCAGGGGACCGG - Intergenic
1053098845 9:35352324-35352346 CAACAGTGGGCCTAGGGGAAGGG - Intronic
1053193916 9:36099868-36099890 CAACAGTGGCACAAGGGAACTGG + Intronic
1053736448 9:41106066-41106088 CAACAGTGGGTCCAGGGGACCGG - Intergenic
1054691923 9:68325334-68325356 CAACAGTGGGTCCAGGGGACCGG + Intergenic
1055031399 9:71774053-71774075 CAGCAGAGGCTTTAGGAGAGAGG + Intronic
1056711047 9:88991840-88991862 CTGCAGCGGCTCTGGGGGAGGGG - Exonic
1060458657 9:123826485-123826507 CAGCAGTGGCTTGAGGGGCATGG - Intronic
1062097777 9:134711850-134711872 AGGCAGTGGCTCTATGGGGCTGG - Intronic
1062520377 9:136955219-136955241 CAGCAGTGGGTCTAGGGGAAGGG - Intronic
1062531041 9:137000519-137000541 GAGCAGGGGCTGCAGGGGACGGG - Intergenic
1185950378 X:4425771-4425793 CAGGAGTGGCTCTAGTTCACAGG + Intergenic
1189187618 X:39067675-39067697 CAGCCTGGGCTCTAGGAGACTGG - Intergenic
1189939254 X:46104281-46104303 CAGCAGTGAGGCTAGGGGAGGGG + Intergenic
1191726157 X:64283259-64283281 CAGCAGTGAGGCTAGGGGAGGGG + Intronic
1192131922 X:68559571-68559593 CAGCAGTGGGTCTCTGGGCCCGG + Intergenic
1192727288 X:73766476-73766498 CAGCAGTGGCCCTAGTGGTTTGG + Intergenic
1195567975 X:106363988-106364010 CCTCAATGGCTCCAGGGGACTGG - Intergenic
1195603141 X:106771460-106771482 CAGCAGTGGGGCTGGGGGAGGGG - Intronic
1196779709 X:119372890-119372912 GAGCAGTGGCTCAAGGGCCCTGG + Intergenic
1197495346 X:127172813-127172835 CAGGAGTGGTTCTAGAGGAACGG + Intergenic
1197509593 X:127354822-127354844 CAACAGTGGGCCCAGGGGACTGG - Intergenic
1197566103 X:128088556-128088578 CAGCAGTGGCACCAGTGCACAGG - Intergenic
1198051609 X:132957397-132957419 CAGCAGCGGCTCCAGGGGAAGGG - Intronic
1198532677 X:137561339-137561361 TAGCAGTGGCTCCAGGTGCCAGG - Intergenic
1199242930 X:145569154-145569176 CAGCAGTGGCAGTAGTGGACTGG - Intergenic
1200087636 X:153616533-153616555 CAGCAATGGGACAAGGGGACTGG + Intergenic