ID: 1075216304

View in Genome Browser
Species Human (GRCh38)
Location 10:120539232-120539254
Sequence ACAGCAGTGGCTCTAGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216304_1075216314 3 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216304_1075216317 23 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216317 10:120539278-120539300 TGGTCACAGGTCAGGTCACTTGG No data
1075216304_1075216311 -9 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216311 10:120539246-120539268 CACTGCTGTTAGAGGCAGAAGGG No data
1075216304_1075216315 10 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216315 10:120539265-120539287 AGGGGTCAGGATATGGTCACAGG No data
1075216304_1075216316 15 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216316 10:120539270-120539292 TCAGGATATGGTCACAGGTCAGG No data
1075216304_1075216318 30 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216318 10:120539285-120539307 AGGTCAGGTCACTTGGAGTTAGG No data
1075216304_1075216313 -3 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216304_1075216312 -8 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216312 10:120539247-120539269 ACTGCTGTTAGAGGCAGAAGGGG No data
1075216304_1075216310 -10 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216310 10:120539245-120539267 CCACTGCTGTTAGAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216304 Original CRISPR ACAGCAGTGGCTCTAGGGGA CGG (reversed) Intronic
900868508 1:5285594-5285616 CCAAGAGTGGCTGTAGGGGAAGG + Intergenic
900913754 1:5620242-5620264 ACAGAAATGGGTCTGGGGGAGGG - Intergenic
901318883 1:8327358-8327380 ATGGCAGTGGCTCTGTGGGATGG - Intronic
901713995 1:11138556-11138578 ACAGCAGAGGCTCCAGTGGCTGG + Intronic
902091556 1:13907619-13907641 ACATCAGTGGCTCCAGGGACTGG - Intergenic
903387316 1:22935960-22935982 ACACCAGTATCTCTAGGGAAGGG + Intergenic
904037091 1:27564789-27564811 AGAGGAGTGGCTCTAAGGGGAGG + Intronic
905265811 1:36753682-36753704 GCAGAAGGGGCTCTAGGGGAAGG + Intergenic
906766133 1:48436090-48436112 ACTTCACTGGCTCTAGTGGATGG - Intronic
907335052 1:53694244-53694266 ACGGCAGGGGCGCTGGGGGAGGG + Intronic
907819396 1:57952402-57952424 ACAGCAGTGGCTTAACTGGAAGG - Intronic
908397699 1:63741259-63741281 CCAGCAGTGGCTGCAGGGCATGG - Intergenic
912474627 1:109927736-109927758 GCAGCAGTCACTCTAGGGGCTGG - Intronic
917207900 1:172596995-172597017 GCAGCAGTGAGGCTAGGGGAGGG - Intronic
917651103 1:177078211-177078233 ACAGCTGGGGCTCTGGGGTAGGG - Intronic
918398092 1:184136317-184136339 GCAGCAGTGAGGCTAGGGGAGGG - Intergenic
920371103 1:205479824-205479846 AGACCAGTGGCTCTTGGGGGTGG + Intergenic
921906965 1:220505422-220505444 ACAGCAGCAGCTCTAGGGAATGG + Intergenic
922383857 1:225061221-225061243 GCAGCAGTGAGGCTAGGGGAGGG - Intronic
922605049 1:226885111-226885133 ACAGCAGTTGCTTCAGCGGATGG + Intronic
922715122 1:227866072-227866094 TTAACAGTGGCTCAAGGGGAGGG - Intergenic
924586185 1:245363106-245363128 ATGGCAGTGGCCCTAGGAGATGG - Intronic
1064068608 10:12205650-12205672 AGAGCAGTGGCTCTAGAGGCAGG - Intronic
1068214680 10:53968285-53968307 GCAGCAGTGAGGCTAGGGGAGGG + Intronic
1069166408 10:65166258-65166280 ACAGAAGTTGCTGCAGGGGAAGG - Intergenic
1070163101 10:73877744-73877766 ACAGCAGTGGGGATAGAGGAGGG - Intergenic
1070429116 10:76318458-76318480 ACAGCAGAGGCTGGTGGGGAGGG - Intronic
1071663590 10:87530910-87530932 GCAGCAGTGAGGCTAGGGGAAGG - Intronic
1072636892 10:97184277-97184299 ACTGCAGTGGCTCTCAGGAAAGG - Intronic
1073610949 10:104942228-104942250 TCAGCAGTTGCTCTAGGAAATGG - Intronic
1074313080 10:112339164-112339186 ACAGGTGTGGCTCTCTGGGATGG + Intergenic
1074454036 10:113582056-113582078 ACAGAAGTGGCCCTGGGGCATGG - Exonic
1075216304 10:120539232-120539254 ACAGCAGTGGCTCTAGGGGACGG - Intronic
1076212620 10:128660575-128660597 ACAGCAGTGGCCCCAGATGAGGG - Intergenic
1077906672 11:6539666-6539688 AAAGCAGTGGCCCTGGGGCAAGG + Intronic
1080398459 11:31911798-31911820 ACAGCTTTGGCACTACGGGAGGG + Intronic
1081091133 11:38867442-38867464 CCTGCAGCTGCTCTAGGGGATGG + Intergenic
1083800868 11:65045603-65045625 ACAGCAGTGGCGGTCGGGGGAGG + Intronic
1084274203 11:68043404-68043426 AGAGCAGGCGCTCTAGGGCAGGG - Exonic
1084361105 11:68669287-68669309 GCAACAGTGGCTCTCGAGGAAGG - Intergenic
1084484351 11:69439192-69439214 CCAGCAGGGGCTCTAGGGCTGGG - Intergenic
1084979017 11:72818925-72818947 ACAACAGCAGCTCTAGGGAAAGG - Intronic
1085304621 11:75478004-75478026 TCAGGAGTGGCTGGAGGGGAAGG - Intronic
1085336651 11:75701860-75701882 ACAGCAGTGGCTGTGGATGAAGG + Intergenic
1087812936 11:102628006-102628028 ACAGCAGTGTCTCTAGTGCATGG + Intergenic
1087936430 11:104038590-104038612 ACTGCAGGGGATCCAGGGGAAGG - Exonic
1089529468 11:119116917-119116939 TGAGCAGTGGCTCTGTGGGAAGG + Exonic
1089695747 11:120215383-120215405 GGCGCAGTTGCTCTAGGGGAGGG + Intronic
1089990240 11:122852615-122852637 GAAGGAGTGGCTCTCGGGGAGGG + Intronic
1092090668 12:5801158-5801180 ACAAGAGTGGCTCCAGGAGAGGG + Intronic
1092191919 12:6527407-6527429 ACATCATTGCCTCTAGTGGAGGG - Intronic
1093336864 12:17915409-17915431 ACAGCAATGGTTATTGGGGAAGG + Intergenic
1094097868 12:26728174-26728196 ACAGCAGCGGGTTTCGGGGATGG - Intronic
1096644302 12:53021705-53021727 ATAGCAGAAGCACTAGGGGAAGG - Intronic
1096870055 12:54587614-54587636 ACAGCCTTGGCTCAAGGGGTGGG - Intronic
1097186224 12:57197960-57197982 TCAGCAGAGGCTCTAGGAGAGGG - Intronic
1098367380 12:69719010-69719032 ACAGCATTGGCTCTATCTGAAGG + Intergenic
1099473019 12:83074512-83074534 GCTGCAGCTGCTCTAGGGGATGG + Intronic
1100000583 12:89830129-89830151 AGAGCAGTAGTTATAGGGGAGGG + Intergenic
1101541478 12:105669370-105669392 ACCACACTGGCTCTAGAGGAAGG - Intergenic
1101577838 12:106014259-106014281 ACAGCAATGGCTCTCAGTGAGGG + Intergenic
1102108830 12:110348747-110348769 GCAGCTGTGGCTCTCGGGAAGGG + Intronic
1102592915 12:113970647-113970669 ACAGCAGTTGCTTCTGGGGAGGG + Intergenic
1103933932 12:124465441-124465463 AGAGCAGTGTCTCCAGGGGCTGG - Intronic
1103998286 12:124843970-124843992 ACAGCAGTGGCCCTTCTGGAAGG + Intronic
1105460810 13:20584805-20584827 ACAGCAGTGGCTCTCAGCGGGGG + Intronic
1106781699 13:33064993-33065015 ACCGCAGTGGCTCTAGGTGGAGG + Exonic
1107149243 13:37092402-37092424 GCAGGAGTGGCTGCAGGGGAAGG + Intergenic
1109655408 13:65384414-65384436 AAACCAGTGGCTCCTGGGGAAGG - Intergenic
1109932560 13:69234997-69235019 GATGCAGTGGCTCTAGGGCAGGG + Intergenic
1112228399 13:97563982-97564004 ACAGGAGAGGCTCTAAGTGATGG - Intergenic
1112735244 13:102408862-102408884 TCAGGAGTGGATCTAGGGAAGGG - Intergenic
1113599988 13:111561681-111561703 ACAGCAGAAGCTCCAGGGGCAGG - Intergenic
1114646462 14:24259100-24259122 CCAGCACTGGCCATAGGGGACGG + Exonic
1121414232 14:93767914-93767936 AGATCAGTGGCTGCAGGGGATGG + Intronic
1121570764 14:94945074-94945096 ACAGGAGTGTGTGTAGGGGATGG - Intergenic
1122294926 14:100700072-100700094 TCTCCAGAGGCTCTAGGGGAGGG - Intergenic
1122985868 14:105211401-105211423 ACACCAGTGGCTCCCGGGGTTGG + Intronic
1124561255 15:30775576-30775598 ACAGCAGCGAGGCTAGGGGAGGG + Intergenic
1125133638 15:36314323-36314345 GCAGCAGTGGCAGTAGGGGAAGG + Intergenic
1125771008 15:42166076-42166098 ACAGCAGTGGATGGAGAGGAGGG - Intronic
1127280875 15:57491368-57491390 AAAGCAGTGGCACTGTGGGAAGG - Intronic
1127386994 15:58474883-58474905 GCAGCAGTTGCTCTCTGGGATGG - Intronic
1128895989 15:71374517-71374539 AAAGTGGTGGTTCTAGGGGAAGG + Intronic
1129652013 15:77497593-77497615 ACAGCAGTGGGTCTGGGGCCAGG + Intergenic
1131442075 15:92466954-92466976 ACAGCAGAGGATCTCGGGGCCGG - Exonic
1132603229 16:783082-783104 TCAGCCTTTGCTCTAGGGGAAGG - Intronic
1133160740 16:3909962-3909984 CCTGCAGAGGCTCTAGAGGAGGG + Intergenic
1133256164 16:4517776-4517798 GCAGCAGTGCCTCTTGGGGCTGG + Intronic
1135298680 16:21305392-21305414 ACATCAATGGTTATAGGGGAGGG - Intergenic
1135740620 16:24972201-24972223 AGAGCAGGGGCTCTGGAGGAGGG + Intronic
1136504142 16:30692049-30692071 ACAGCAGTGGCTGGAGTGCAGGG + Intergenic
1137360827 16:47813679-47813701 GCAGCAGTGAGGCTAGGGGAGGG - Intergenic
1141878310 16:86841568-86841590 ACAGCTGGGGCTCTAGGGCCAGG - Intergenic
1141896467 16:86961820-86961842 CCTGCGGTGGCTCTAAGGGAGGG + Intergenic
1143159375 17:4859065-4859087 ACAGCACTGGCTCTAGCAGCAGG + Intronic
1143433919 17:6908705-6908727 ACAGCAGTGGCACCATGGTAAGG + Intronic
1145937842 17:28725733-28725755 GCCGCAGTGGCCCCAGGGGAGGG - Intronic
1149996851 17:61410202-61410224 GCAGGAGTGGGTCTCGGGGAAGG - Intergenic
1155426932 18:25716566-25716588 ACAGCAGTGAGGCTGGGGGAGGG + Intergenic
1156466884 18:37353424-37353446 AGAGCAGTGGATGTGGGGGAAGG + Intronic
1157712289 18:49858344-49858366 ACTGCAGTGATTCTTGGGGAGGG + Intronic
1158396034 18:57078842-57078864 GCAGCAGTGGGTGTCGGGGAGGG + Intergenic
1160270010 18:77375188-77375210 ACAGCAGTGTCTCTCGGCGAAGG + Intergenic
1160991761 19:1863111-1863133 ACAGCGGTGGCTCTTGGCGGCGG + Exonic
1161275460 19:3413981-3414003 ACATCAGTGCCTCGAGAGGAGGG + Intronic
1162156852 19:8684306-8684328 ACACCAGTGGCCTTAGGGGAGGG - Intergenic
1162378032 19:10316526-10316548 ACAGCAGAGGCTCCGGGAGATGG + Exonic
1163485168 19:17581127-17581149 GCAGCAATGGCTTCAGGGGACGG - Intronic
1163756565 19:19109996-19110018 TGAGCAGTGGCTCTAGGAGTTGG + Intronic
1164637225 19:29800333-29800355 ACAGCAGGGCCTCCTGGGGAGGG + Intergenic
1164905085 19:31960630-31960652 ACAGCGGTGGCTCTAGCAGCCGG + Intergenic
1165103697 19:33456340-33456362 ACAGCCCTGGCTCTTGGGAAGGG + Intronic
1165444453 19:35849229-35849251 ACTGCAGTGGCTGAAGGTGAGGG - Exonic
1166053444 19:40274755-40274777 ACAGGAGTGGGTGAAGGGGAGGG + Intronic
1166171856 19:41033481-41033503 ACAGCAGTGAGGCTGGGGGAGGG + Intergenic
1166267796 19:41695841-41695863 ACAGAGGTGGCTCTGGGGGCTGG - Intronic
1166407053 19:42528859-42528881 ACAGAGGTGGCTCTGGGGGATGG + Intronic
1166597964 19:44067554-44067576 AGAACAGTGGCTCTAGAGGCAGG - Exonic
1166744346 19:45133502-45133524 ACAGCTGTGGCCCTGAGGGATGG - Intronic
1167035533 19:46993135-46993157 AAAGCCGTGTCTCCAGGGGAAGG + Intronic
1167213361 19:48147945-48147967 ACAGCCCTGGCTCTGTGGGAAGG + Intronic
1167719325 19:51167898-51167920 CCAGGAGTGGCACAAGGGGAAGG + Intergenic
1168374371 19:55863531-55863553 ACAGGAACAGCTCTAGGGGATGG + Intronic
1168573758 19:57491331-57491353 GCATCAGTGGCTCTGGGGCAGGG + Intronic
925054429 2:846253-846275 CCAGCAGTGGCTCTATGCCAGGG + Intergenic
925066667 2:933152-933174 TCAGCACTTTCTCTAGGGGAGGG - Intergenic
925818190 2:7773827-7773849 ACAGCAGTGGCTCTCAAGGCGGG + Intergenic
925975475 2:9139035-9139057 ACAGGAGGGGCGCTGGGGGAAGG - Intergenic
925983077 2:9192751-9192773 ACAGAACTGTCTTTAGGGGAGGG - Intergenic
926929322 2:18021559-18021581 ACACCTGTGTGTCTAGGGGATGG + Intronic
927922547 2:26984512-26984534 ACAGCAGTGGCACCAGGGGGTGG + Intronic
928199197 2:29236395-29236417 ACAGCAGTGGGGCTTGAGGATGG + Intronic
930101760 2:47608859-47608881 TCAGCAGTGGGTATAAGGGATGG + Intergenic
931045049 2:58341608-58341630 ACAACAGTGGGTCAAGTGGATGG - Intergenic
931440877 2:62289496-62289518 TCAGCAGAGGCTCTAGGTGGAGG - Intergenic
934780172 2:96964935-96964957 ACAGCAGGGGCCCAAGGGTATGG - Intronic
937040776 2:118818945-118818967 ACAGCGCTGGCGCCAGGGGATGG + Intergenic
937822316 2:126324645-126324667 AAATCAGTTGCTCCAGGGGAGGG + Intergenic
939677798 2:145094074-145094096 CCAGGAGTGGTTCTAGAGGATGG - Intergenic
940558384 2:155262271-155262293 ACAGCAGTGCTTCCAGGGGTCGG - Intergenic
944516965 2:200522024-200522046 AAAGCATTGGGTGTAGGGGAGGG - Intronic
944616898 2:201469983-201470005 ACTTCACTGGCTCTAGTGGATGG - Exonic
945677740 2:212876116-212876138 GCAGCAGTGAGGCTAGGGGAGGG + Intergenic
946837165 2:223783975-223783997 AGAGCAGTGGCGTTAAGGGATGG - Intronic
947933622 2:233984668-233984690 TCAGAAGGGGCTCGAGGGGAAGG - Intronic
948436622 2:237958088-237958110 AGAGCTGTGGCTGCAGGGGAAGG + Intergenic
1168829072 20:834442-834464 CCAGCAGCGGCTCTGGGGGCTGG - Intronic
1171230081 20:23477241-23477263 ACAGAGGGGGCTCTGGGGGATGG - Intergenic
1171310092 20:24138918-24138940 ACGGGAGTGGCTCTAGGCAAAGG - Intergenic
1174067250 20:47874541-47874563 ACAGCAGGGGCTCTGGTGCAGGG + Intergenic
1174340161 20:49890535-49890557 ACAGCAGTGCCTGTGGTGGAGGG - Exonic
1174410766 20:50333615-50333637 ACTGCAGTGGCTTTGGGGGTAGG - Intergenic
1174571303 20:51503677-51503699 ACAACAGTGGCTCATGGGGCAGG - Intronic
1175741693 20:61424547-61424569 ACATCAGTGGCTGCAGTGGAGGG - Intronic
1175872895 20:62216777-62216799 ATAGCAGTGGCCCTCGGGGATGG + Exonic
1177180436 21:17739098-17739120 CCAGCAGTGGCACTAGGAAAGGG - Intergenic
1177975282 21:27841815-27841837 ACACCAGTGCCTATAGGGGGTGG - Intergenic
1179715192 21:43282690-43282712 ACAGCAGGTGCTCAAGGGGCTGG - Intergenic
1180239263 21:46489386-46489408 ACAGCTGTGGCTGTTGGGGTGGG + Intronic
1181637192 22:24180005-24180027 ACAGCACTGGGTGCAGGGGAGGG - Intergenic
1185187523 22:49411270-49411292 ACAGCAGTGGCAGTGGGGGGGGG - Intergenic
949320627 3:2806278-2806300 ACATCAGTGGCTCTACTGTAAGG - Intronic
950443330 3:13022438-13022460 ACAGCAGTGGCTGCAGGCCAGGG + Intronic
952315293 3:32227072-32227094 ACAGCAGTGCCTCCTGGAGATGG - Intergenic
954188134 3:48935942-48935964 GAACCAGAGGCTCTAGGGGAAGG - Intronic
954317369 3:49808394-49808416 ACATCAGAGGCTTCAGGGGAGGG + Exonic
954710663 3:52503714-52503736 ACACCAGTGGTTCTTGGGGTTGG + Intronic
956614842 3:71160317-71160339 TCAGCATTGGCTCTAGGTGGAGG + Intronic
956850643 3:73225164-73225186 GCTGCAGTGGCAATAGGGGAGGG + Intergenic
957866899 3:86037421-86037443 ACAGCAGTGACTTTAAGAGAGGG + Intronic
958897245 3:99842921-99842943 ACAGCATTGCCTTTGGGGGATGG + Intronic
959687149 3:109159865-109159887 CCAGCAGTCACTCTAGGGGCTGG - Intergenic
965184561 3:165446530-165446552 ACTGCAGCTGCTGTAGGGGATGG - Intergenic
967864784 3:194181268-194181290 TCATCAGCAGCTCTAGGGGAGGG - Intergenic
968966139 4:3769927-3769949 ACAGCAGTGGGGGCAGGGGAGGG + Intergenic
971292897 4:25360747-25360769 ACAGCAATGGCTCAAGGTGTAGG - Intronic
971362971 4:25953789-25953811 ACAGCAGGGGCTTGAGGAGAAGG - Intergenic
971881847 4:32384981-32385003 GCAGCTGGGGGTCTAGGGGAGGG + Intergenic
973650810 4:52995452-52995474 ACAATAGTTGCTCTAGGGCAAGG - Intronic
975085948 4:70340194-70340216 ACAGGAATGGATCAAGGGGAAGG - Intergenic
975401151 4:73941232-73941254 ACAGCAGTGGTTATAGTGAAGGG + Intergenic
976999601 4:91481100-91481122 AAAGGAGAGGCTGTAGGGGAGGG - Intronic
977087241 4:92617381-92617403 ACAGCAGGGCCTGTCGGGGATGG - Intronic
983283918 4:165715517-165715539 ATAGCAGAGGCTCTAGGATAAGG - Intergenic
983522616 4:168725955-168725977 AAAGCAGTGGCTATGAGGGAAGG - Intronic
984925973 4:184807406-184807428 ACAGGAGTGGCTGTAGAGGAAGG - Intronic
985545732 5:508082-508104 ACACCAGTGGAGCCAGGGGAAGG + Intronic
986036653 5:3947135-3947157 TCAGCTGTGGCTCTGGGGAACGG + Intergenic
986044612 5:4025145-4025167 TCATCAGTGGCTCAGGGGGATGG - Intergenic
986195437 5:5533400-5533422 GCAGCAGTGGCTCTGTGGGGAGG + Intergenic
986299691 5:6468187-6468209 ACAGCAGTGGCTGGAAAGGAAGG - Intronic
989049181 5:37301953-37301975 AAAGCAGAGGCCCTAGGGAATGG + Intronic
989844886 5:46129373-46129395 GCAGCAGTGGGACTGGGGGAGGG + Intergenic
990239577 5:53803205-53803227 GCAGCAGTGAGGCTAGGGGAGGG + Intergenic
993883882 5:93394765-93394787 GCAGCAGTGGCTATGGCGGATGG + Intergenic
994597786 5:101860973-101860995 ACTGCACTGGTTGTAGGGGAGGG - Intergenic
994969668 5:106719449-106719471 GCAGCAGTGAGGCTAGGGGAGGG - Intergenic
996336317 5:122387637-122387659 ACTGCTGTGACTCCAGGGGAAGG - Intronic
996356113 5:122598233-122598255 GCAGCAGTGAGGCTAGGGGAGGG - Intergenic
996601129 5:125265164-125265186 ACAGCAGTGGCTCTGAGAGTGGG - Intergenic
997142427 5:131397048-131397070 GCAGCGGAGGCTCTGGGGGAAGG - Intronic
1000408798 5:160916792-160916814 ACAGCTGAGGCTCAAGGGGCTGG + Intergenic
1001384315 5:171325847-171325869 ACAGCAGTGGCTGTAAGAGGGGG + Intergenic
1001529239 5:172450921-172450943 AGGGCAGTGGCTCCAGGGAAAGG + Intronic
1002060066 5:176620738-176620760 ACAGCCCTGGCTCTGGGGGGCGG + Exonic
1002301394 5:178259330-178259352 ACATCAGTGGCACCAGGGGCTGG + Intronic
1003915845 6:10785625-10785647 ACAGCAGTGGGCTCAGGGGAAGG - Intronic
1006946608 6:37788571-37788593 ACAGCAGTGGCTCTCAGAGAGGG - Intergenic
1008641938 6:53473492-53473514 ACAGCAATGGGTCTTGCGGAAGG + Intergenic
1011081641 6:83496080-83496102 GCAGCAGTGGGGCTGGGGGAGGG + Intergenic
1015304951 6:131697083-131697105 CCAGCAGTAGCTCTAGGGCAAGG + Intronic
1017574526 6:155787420-155787442 ACAACAGTGGCTCCAGGCCAAGG - Intergenic
1018015049 6:159704559-159704581 GCAGCAGTGAGGCTAGGGGAGGG + Intronic
1018216762 6:161535845-161535867 ACTGCAGTGGCTTAAGGGGATGG - Intronic
1019100323 6:169624734-169624756 ACAGCAAGGGCTCTAGTTGACGG - Intronic
1019326807 7:442528-442550 TCAGATGTGGCTCTAGGTGAGGG - Intergenic
1019350372 7:551585-551607 TCGGCAGTGGCTCTGGGAGAAGG - Intronic
1019350641 7:552445-552467 ATGGCAGTGGCTCTGCGGGAAGG - Intronic
1022124060 7:27338782-27338804 ACAGGTGTGGCTCTTGGGCATGG - Intergenic
1022204589 7:28151063-28151085 ACAGCAGTAGCTCTTGGGAGGGG + Intronic
1022287230 7:28965194-28965216 ACATCTGCAGCTCTAGGGGAGGG - Intergenic
1022977958 7:35575811-35575833 ACAGCAGAGCCTCAAGGGGAAGG + Intergenic
1026474380 7:70721786-70721808 AGAACAGTGGATCTAGGTGAAGG - Intronic
1026824693 7:73574111-73574133 CCCGCTGTGGCTCTAGGGGAAGG + Exonic
1029582725 7:101448041-101448063 ACAGCACTGGTGCCAGGGGAAGG + Intronic
1029628079 7:101732949-101732971 ACAGCAGGGACTCTAAGGAAGGG - Intergenic
1030598925 7:111570953-111570975 ATGGCAGTGGCTATAGGGTAAGG + Intergenic
1031239415 7:119219200-119219222 ACAGGAGTGGGTCTAGGTGCTGG + Intergenic
1031648637 7:124258532-124258554 ACAGAAGTGGCTTTAGGGTTGGG + Intergenic
1032492178 7:132331849-132331871 ACAGCAGTGGCTGTAGGATGGGG - Intronic
1034256485 7:149727475-149727497 ACAGCAGTGGCAGGAGGGGCTGG - Intronic
1034355105 7:150445190-150445212 GAAGCTGTGGCTCTGGGGGAGGG + Intergenic
1034362567 7:150513671-150513693 ACTTCACTGGCTCTAGTGGATGG + Intergenic
1035619321 8:1025654-1025676 CCAGGCATGGCTCTAGGGGAGGG - Intergenic
1036149553 8:6284809-6284831 ATAGCAGTGGCTACAGTGGAGGG + Intergenic
1036563600 8:9919161-9919183 GCAGCAGTTGCTCTAGGGGGTGG - Intergenic
1037703736 8:21297863-21297885 CCAGCTCTGGCTGTAGGGGAAGG - Intergenic
1040404421 8:47086237-47086259 ACAGCATTAGCTCAAGGGCAAGG + Intergenic
1040897808 8:52387515-52387537 ACAGCACTGTCTCTTAGGGAAGG - Intronic
1041589105 8:59556052-59556074 ATCCCAGTGGCTCTAGGGGAAGG - Intergenic
1043341826 8:79249181-79249203 GTAGCAGTGGCTCTAGCAGATGG - Intergenic
1044703285 8:94983896-94983918 AAATCAGGGTCTCTAGGGGAGGG + Intronic
1044871649 8:96625808-96625830 ACAGCATTGGCTCTTGAGGAAGG + Intergenic
1045290025 8:100825083-100825105 AGGGCAGTGGCTCTTGGGAATGG + Intergenic
1045431759 8:102121636-102121658 TCAGATGTGGCTGTAGGGGATGG - Intronic
1045878944 8:107015102-107015124 ACAGCAGTGGTTCTAGAGCCTGG - Intergenic
1047219764 8:122910004-122910026 ACAGCAGAGGCTCAGGGGCATGG - Intronic
1048476744 8:134749743-134749765 ACAGAAGTGGCTATAGGTAAAGG - Intergenic
1049254011 8:141604514-141604536 AGGCCAGTGGCTCTCGGGGAAGG - Intergenic
1049382405 8:142323892-142323914 ACAGCAGTGGATCCAGTGCAGGG + Intronic
1049439310 8:142601960-142601982 ACAGCAGTGACACCAGGGGTGGG + Intergenic
1053098846 9:35352325-35352347 ACAACAGTGGGCCTAGGGGAAGG - Intronic
1053308401 9:37000117-37000139 CCTGCAGTGGCCCTAGGGGGAGG - Intronic
1053348894 9:37398787-37398809 CTGGCAGTGGCTCTGGGGGATGG - Intergenic
1055017547 9:71634758-71634780 ATAGTAGGGGCTTTAGGGGAGGG + Intergenic
1055030807 9:71769676-71769698 ACAGCCTTGGCTCTGGGTGAGGG + Intronic
1055662555 9:78519875-78519897 ACAGCAGTGGCTATGGGCAATGG - Intergenic
1056390505 9:86136973-86136995 ACAGCAGTGTCTCAAGGGTAAGG - Intergenic
1056711048 9:88991841-88991863 CCTGCAGCGGCTCTGGGGGAGGG - Exonic
1057217728 9:93238714-93238736 ACGCCAGTGGCTCTAGGTGTGGG + Intronic
1057242028 9:93419822-93419844 ACAGAAGTGGCTCTATGACATGG - Intergenic
1057516360 9:95725254-95725276 ACAGCAGTGCCTCTGGTGGGGGG + Intergenic
1057796338 9:98160696-98160718 CCAGCAGTTGCTCAAGGTGAGGG - Intronic
1059459050 9:114418196-114418218 ACAGCAGTCGCTCCTGAGGAAGG + Intronic
1062344970 9:136110404-136110426 ACAGCAGGGGCTGAGGGGGAAGG - Intergenic
1062519122 9:136950330-136950352 GCAGGAGTGGGTCTGGGGGAGGG + Intronic
1062520378 9:136955220-136955242 CCAGCAGTGGGTCTAGGGGAAGG - Intronic
1203774028 EBV:62907-62929 ACAGCAGCGGCGGTAGCGGAGGG - Intergenic
1203786234 EBV:129400-129422 ACAGCAGTTGGTATAGGGCAAGG + Intergenic
1185653678 X:1667408-1667430 CCTCCAGAGGCTCTAGGGGAGGG + Intergenic
1185704948 X:2260022-2260044 CCTCCAGAGGCTCTAGGGGAGGG + Intronic
1187053273 X:15715179-15715201 ACAGTGGTGGCCCCAGGGGATGG + Intronic
1188568622 X:31555147-31555169 AAATAACTGGCTCTAGGGGAGGG + Intronic
1188968902 X:36588907-36588929 GCAGCATTGCCTCCAGGGGAAGG + Intergenic
1189939253 X:46104280-46104302 GCAGCAGTGAGGCTAGGGGAGGG + Intergenic
1190632539 X:52401582-52401604 CCAGCATTGGCTTTAGGGTATGG + Intergenic
1191726156 X:64283258-64283280 GCAGCAGTGAGGCTAGGGGAGGG + Intronic
1192565113 X:72157145-72157167 TCAGCAGTGGCTCCACTGGATGG - Intergenic
1193293508 X:79806200-79806222 ACAGCAGTGGCAATATGGGCTGG - Intergenic
1195064361 X:101226647-101226669 CCAGCAGGGTCCCTAGGGGAGGG + Intronic
1195603142 X:106771461-106771483 GCAGCAGTGGGGCTGGGGGAGGG - Intronic
1198051610 X:132957398-132957420 GCAGCAGCGGCTCCAGGGGAAGG - Intronic
1198498763 X:137221408-137221430 AGTGTAGTGGCTCTAGAGGATGG + Intergenic
1199779001 X:151041153-151041175 ACAGCAGTGAGGCTGGGGGAGGG - Intergenic
1200050977 X:153431597-153431619 CCTCCAGAGGCTCTAGGGGAGGG - Intergenic
1201466084 Y:14282585-14282607 GCAGCAGTGAGGCTAGGGGAGGG + Intergenic