ID: 1075216305

View in Genome Browser
Species Human (GRCh38)
Location 10:120539236-120539258
Sequence TCTAACAGCAGTGGCTCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216305_1075216316 11 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216316 10:120539270-120539292 TCAGGATATGGTCACAGGTCAGG No data
1075216305_1075216318 26 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216318 10:120539285-120539307 AGGTCAGGTCACTTGGAGTTAGG No data
1075216305_1075216315 6 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216315 10:120539265-120539287 AGGGGTCAGGATATGGTCACAGG No data
1075216305_1075216313 -7 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216305_1075216314 -1 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216305_1075216317 19 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216317 10:120539278-120539300 TGGTCACAGGTCAGGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216305 Original CRISPR TCTAACAGCAGTGGCTCTAG GGG (reversed) Intronic
No off target data available for this crispr