ID: 1075216306

View in Genome Browser
Species Human (GRCh38)
Location 10:120539237-120539259
Sequence CTCTAACAGCAGTGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216306_1075216318 25 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216318 10:120539285-120539307 AGGTCAGGTCACTTGGAGTTAGG No data
1075216306_1075216315 5 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216315 10:120539265-120539287 AGGGGTCAGGATATGGTCACAGG No data
1075216306_1075216317 18 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216317 10:120539278-120539300 TGGTCACAGGTCAGGTCACTTGG No data
1075216306_1075216313 -8 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216306_1075216314 -2 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216306_1075216316 10 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216316 10:120539270-120539292 TCAGGATATGGTCACAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216306 Original CRISPR CTCTAACAGCAGTGGCTCTA GGG (reversed) Intronic