ID: 1075216306

View in Genome Browser
Species Human (GRCh38)
Location 10:120539237-120539259
Sequence CTCTAACAGCAGTGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216306_1075216318 25 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216318 10:120539285-120539307 AGGTCAGGTCACTTGGAGTTAGG No data
1075216306_1075216314 -2 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216306_1075216315 5 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216315 10:120539265-120539287 AGGGGTCAGGATATGGTCACAGG No data
1075216306_1075216313 -8 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216306_1075216316 10 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216316 10:120539270-120539292 TCAGGATATGGTCACAGGTCAGG No data
1075216306_1075216317 18 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216317 10:120539278-120539300 TGGTCACAGGTCAGGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216306 Original CRISPR CTCTAACAGCAGTGGCTCTA GGG (reversed) Intronic
901318886 1:8327363-8327385 CCCTAATGGCAGTGGCTCTGTGG - Intronic
902943325 1:19815888-19815910 ATACAACAGCTGTGGCTCTAAGG - Intergenic
902984679 1:20148396-20148418 CTCAAACCTCAGAGGCTCTAGGG - Exonic
904886206 1:33740457-33740479 CAGAAACAGCAGTGGCCCTAGGG + Intronic
905076174 1:35272537-35272559 CTAGTACAGCAGAGGCTCTATGG + Intronic
907809745 1:57856812-57856834 CTCTAACAGAAGGGTCTCAATGG + Intronic
910731039 1:90396813-90396835 TTCTAATTACAGTGGCTCTAGGG + Intergenic
917222516 1:172747192-172747214 ATCTGACAGCAGTGGCTGTCAGG - Intergenic
924173897 1:241369696-241369718 CTCTCTCTGCAGTGGCTCAACGG - Intergenic
1064202196 10:13294264-13294286 CTCTAAGAGCAGTGGTTCCTGGG + Intronic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1071726954 10:88208476-88208498 TTGTAACTACAGTGGCTCTAGGG - Intergenic
1073318109 10:102597055-102597077 CTGTAAGAGCAGTGGCTGAAAGG + Intronic
1074858368 10:117490374-117490396 TTCTTAAAGCAGTGGCACTAGGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1077169717 11:1160756-1160778 CCCTAAGACCAGTGGCCCTAGGG - Intronic
1078868855 11:15325320-15325342 CCCTAAAAGCTGTGGCTCTTTGG + Intergenic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1080009540 11:27443816-27443838 ATCCAACAGCAGCTGCTCTATGG + Intronic
1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG + Intronic
1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG + Intronic
1084093257 11:66893290-66893312 CTCTGTCAGGAGTGGCTCTTAGG - Intronic
1084685756 11:70694195-70694217 GTCAAACAGCAGAGGCCCTAAGG - Intronic
1087910953 11:103752836-103752858 CACTTACTGCAGAGGCTCTATGG - Intergenic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1089926058 11:122258961-122258983 CTCTAACTCAACTGGCTCTAGGG + Intergenic
1092645536 12:10567453-10567475 GTCCAACAGTAGTGGCACTAGGG + Intergenic
1098268832 12:68750615-68750637 CTGGAACAGCAGGGGCTCTCAGG - Intronic
1098746925 12:74249807-74249829 CTTTAACAGAAGTTGCTCTCAGG + Intergenic
1102534809 12:113573531-113573553 CTGTCACAACATTGGCTCTAGGG - Intergenic
1103870124 12:124085423-124085445 CTGGAACAGCCGTGGCACTAGGG - Intronic
1111665884 13:91267338-91267360 CACTCACAGCAGTGCCTCTCAGG + Intergenic
1113600477 13:111564935-111564957 CTCCAATAGCAGAGGCTCTTGGG + Intergenic
1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG + Intergenic
1120916674 14:89716583-89716605 CTCTAACTGCAGTGCCTCCCTGG + Intergenic
1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG + Intronic
1125406619 15:39358855-39358877 TCCTAGCAGCAGTGGCTCTATGG - Intergenic
1126152426 15:45535635-45535657 CTCTAACAGCTGGGGCTCCTTGG + Intergenic
1127435873 15:58957665-58957687 CTCTCGAAGCATTGGCTCTATGG - Intronic
1133825630 16:9275728-9275750 CTCTAACAGCATTTGCGCTTTGG - Intergenic
1135304621 16:21357368-21357390 CTCCAACAGCAGTGGCTGTTTGG - Intergenic
1136301364 16:29336495-29336517 CTCCAACAGCAGTGGCTATTTGG - Intergenic
1138738558 16:59280548-59280570 CTATAGCAGAAGTGGCTCTTGGG - Intergenic
1139441565 16:66970525-66970547 ATCTGACAGCTGAGGCTCTAGGG - Intronic
1142063061 16:88043192-88043214 CTCCAACAGCAGTGGCTGTTTGG - Intronic
1146595857 17:34168080-34168102 CTGCACCAGCAGTGGCACTATGG - Intronic
1147040743 17:37716722-37716744 CTCTATGAGCTGTAGCTCTAAGG - Intronic
1149696317 17:58619114-58619136 CTCTAGCAGCAGTGGAACTGGGG + Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1157695929 18:49723677-49723699 CTCTCACAGCCGTGGCTCAAAGG + Intergenic
1157760449 18:50259952-50259974 TTCTAAGAGCTGTAGCTCTAGGG + Intronic
1158970967 18:62666011-62666033 CTCTCACAGGAGTCACTCTATGG + Intergenic
1163338452 19:16688593-16688615 CTCCAAAAGCTGTGACTCTATGG - Exonic
1163605688 19:18274190-18274212 CCCTCACAGCAGGGGCTCTAGGG - Intronic
1163846644 19:19641969-19641991 CACTCACAACAGTGGCTGTAGGG + Exonic
1166807142 19:45494266-45494288 CTCTTCCAGCAATGGCTCTTCGG + Exonic
927922544 2:26984507-26984529 CTCAGACAGCAGTGGCACCAGGG + Intronic
929052813 2:37852570-37852592 CTGTCACAGAAGTGGCTTTATGG - Intergenic
932141150 2:69279377-69279399 TTCTAAGAGCAGTGACTATATGG + Intergenic
936327620 2:111519303-111519325 CTCCACCAGCAGTTTCTCTAGGG + Intergenic
937792297 2:125974902-125974924 CTCTGACAGCAATGGGTCCAAGG - Intergenic
939985913 2:148829821-148829843 CTCCACCAGCAGGGGCTCTCAGG + Intergenic
946364098 2:219237825-219237847 GTCTAACAGCAGTGACTTCAAGG - Exonic
946419438 2:219556707-219556729 CTTCACCAGCAGTGGCTCTAAGG + Exonic
946516445 2:220416878-220416900 CTCTGACAGGTGTGGCTCAAAGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
947163135 2:227234678-227234700 ATCTAACTGCAGAGGCTCAATGG + Intronic
1168789030 20:563646-563668 CTCTCCCCTCAGTGGCTCTAGGG - Intergenic
1176058652 20:63162106-63162128 CTCTATCAGCACGGGCTCTCTGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179168125 21:38951285-38951307 CTCTAACATCTGTGGTTCTTAGG - Intergenic
1183254081 22:36749635-36749657 CTCCAACAGCACAGGCTGTAGGG + Intergenic
1183818488 22:40324071-40324093 CTTTAGTAGCAGTGGCTCTCCGG - Exonic
949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG + Intergenic
949642004 3:6046785-6046807 CTGTAGCAGCTGTGGCACTAGGG - Intergenic
959687152 3:109159870-109159892 TTCTACCAGCAGTCACTCTAGGG - Intergenic
960156297 3:114299968-114299990 CTCTCAGAGCAGTGGCTTAAGGG - Intronic
961763764 3:129191754-129191776 CTCTAAAAGCAGTGTGCCTAGGG - Intergenic
961779069 3:129310964-129310986 CCCTAACAGCAGTTGCTGTGGGG + Intergenic
964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG + Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
969843000 4:9897294-9897316 CTCCAACAGCACTGGCACTGGGG + Intronic
970852769 4:20621277-20621299 CTCAAAAAACAGTGGCTATATGG - Intergenic
972041344 4:34604028-34604050 CTCTAACAGCTGTGGTTGGATGG + Intergenic
973928343 4:55763116-55763138 ATCTAACAGCAGCTACTCTAAGG - Intergenic
975871809 4:78787460-78787482 GTCTAACGGTAGTGGCTCAAGGG - Intronic
992627224 5:78647453-78647475 CTCTAACAGCTCTGGCTCGCCGG + Intronic
994312259 5:98287269-98287291 CTCCAACACTAGTGTCTCTAGGG + Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1002932618 6:1644793-1644815 CTCTGACAGCTTTGGCTCTCAGG + Intronic
1010499980 6:76586062-76586084 CTATAACAGCAGTTCCTATAGGG - Intergenic
1013153320 6:107468144-107468166 CTCTAACTACAGTTGTTCTAAGG - Intergenic
1016085169 6:139904542-139904564 TTCTAAAAACAGTGGCTTTAAGG + Intergenic
1017751516 6:157493564-157493586 CTCTCACAGCAGTGGGCCTGTGG - Intronic
1018198603 6:161376121-161376143 CTGAAGCAGCAGTGGCTCCAGGG - Intronic
1020017910 7:4842253-4842275 CTCTCACAGCAGAGGCCGTAAGG + Intronic
1021262857 7:18480472-18480494 CTGGCACAGCAGTTGCTCTATGG - Intronic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1023959180 7:44912515-44912537 TTCTAACAGCTGGGGCTCTCAGG + Intergenic
1024934501 7:54698824-54698846 CTCTATCAGCAGAGGCTCTCAGG + Intergenic
1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG + Intronic
1034733465 7:153408659-153408681 GTCTAACAACAGTGGCACAAAGG - Intergenic
1036922713 8:12873178-12873200 CTGTAGCAACAGTGGCCCTAAGG - Intergenic
1042808880 8:72802317-72802339 TTCTAAGAGCAGTGACTATATGG - Intronic
1045290024 8:100825078-100825100 CTCTAAGGGCAGTGGCTCTTGGG + Intergenic
1046601327 8:116320435-116320457 CTCTAAAGGCAGTGTCCCTAAGG + Intergenic
1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG + Intergenic
1053450207 9:38187391-38187413 GTATAGCAGCTGTGGCTCTAAGG - Intergenic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1059587076 9:115618552-115618574 CTCTAACAGTAGAGCATCTATGG + Intergenic
1061871519 9:133523308-133523330 CTCCAGCAGCAGGGCCTCTATGG - Intronic
1188993718 X:36856017-36856039 CTCTCACAGCCAGGGCTCTATGG + Intergenic
1193084447 X:77436851-77436873 CTTTAAAAGCAGTTGCTTTATGG + Intergenic
1197259650 X:124304641-124304663 CCAGATCAGCAGTGGCTCTAAGG - Intronic
1198806257 X:140498409-140498431 CTCTAAAAGAAGTGGTGCTAGGG + Intergenic