ID: 1075216307

View in Genome Browser
Species Human (GRCh38)
Location 10:120539238-120539260
Sequence CCTCTAACAGCAGTGGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216307_1075216318 24 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216318 10:120539285-120539307 AGGTCAGGTCACTTGGAGTTAGG No data
1075216307_1075216317 17 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216317 10:120539278-120539300 TGGTCACAGGTCAGGTCACTTGG No data
1075216307_1075216313 -9 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216307_1075216314 -3 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216307_1075216316 9 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216316 10:120539270-120539292 TCAGGATATGGTCACAGGTCAGG No data
1075216307_1075216315 4 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216315 10:120539265-120539287 AGGGGTCAGGATATGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216307 Original CRISPR CCTCTAACAGCAGTGGCTCT AGG (reversed) Intronic
900475647 1:2875195-2875217 GCTCTATCAACAGAGGCTCTTGG - Intergenic
901311980 1:8276371-8276393 CCTCGAACGCCAGTGCCTCTGGG - Intergenic
902614542 1:17616631-17616653 CATGTATCAGCAGTGCCTCTGGG + Intronic
903064976 1:20694504-20694526 CCTCTGTCAGCAGTGGCTCCAGG - Intronic
903738781 1:25546105-25546127 CCTCTGACAGCAGTGGCCACAGG + Intronic
904034457 1:27551335-27551357 CCTCTAGCAGCTGGGCCTCTGGG + Exonic
905450789 1:38054762-38054784 CCTACAACCCCAGTGGCTCTGGG + Intergenic
905715233 1:40143875-40143897 CCTCGAGCAGCAGTGGCAGTGGG - Intergenic
907865227 1:58392763-58392785 CCACTGAAAGCACTGGCTCTTGG + Intronic
910292998 1:85616733-85616755 CCTTTAAAAGCTGGGGCTCTGGG - Intergenic
915138317 1:153749630-153749652 CCAATAACAGAAGTGGCTCCAGG - Intronic
919445042 1:197692806-197692828 CCTATAAAAGCAGTTGTTCTTGG + Intronic
922047469 1:221960451-221960473 CCTAAAACAGCAGTTGCTATTGG - Intergenic
922984537 1:229856109-229856131 CCTCTCAAGGCAGTGGCTTTGGG - Intergenic
1064202195 10:13294263-13294285 GCTCTAAGAGCAGTGGTTCCTGG + Intronic
1067427270 10:46219832-46219854 CCTCAGACATCAGTGGCTCAGGG - Intergenic
1071324724 10:84501911-84501933 CATCTAAAAGCACTGGCCCTAGG + Intronic
1072152217 10:92692025-92692047 CCTCTTTCCCCAGTGGCTCTCGG - Intronic
1073821056 10:107264632-107264654 CCTGTATCAGCAGAGGCCCTGGG + Intergenic
1074353243 10:112758536-112758558 CCTCTTGCAGCATTGGGTCTTGG - Intronic
1075199957 10:120394411-120394433 CCTCCAACAGCAGGGGCTCTTGG - Intergenic
1075216307 10:120539238-120539260 CCTCTAACAGCAGTGGCTCTAGG - Intronic
1075352847 10:121740413-121740435 TTTCTATCTGCAGTGGCTCTTGG - Exonic
1076705092 10:132297143-132297165 CCTCTGGCTGCTGTGGCTCTGGG + Intronic
1077854427 11:6108287-6108309 CCTGGAACAGTAGTGTCTCTGGG - Exonic
1077955268 11:7012495-7012517 CCTCTCAAAGGACTGGCTCTTGG - Intronic
1079325420 11:19487008-19487030 CCTCTACCATTAGAGGCTCTGGG + Intronic
1080189076 11:29523934-29523956 CCTCTAGAAGCGGAGGCTCTGGG - Intergenic
1081669739 11:44936401-44936423 GTTCAAACAGAAGTGGCTCTGGG + Intronic
1081866073 11:46361473-46361495 CCTCTCCCAGCAGCGGCTCCAGG - Intronic
1083800864 11:65045597-65045619 GCTCTTACAGCAGTGGCGGTCGG + Intronic
1085066177 11:73498097-73498119 CAGCTAAGAGCAGTGACTCTGGG + Intronic
1086241281 11:84695261-84695283 CCTCTGCCAGCAGTGCATCTTGG - Intronic
1087680535 11:101214400-101214422 CCTCCTTCAGCAGTGGATCTCGG - Intergenic
1091665983 12:2418849-2418871 CCTCTACAAGCAGTGGAGCTGGG - Intronic
1091774032 12:3172624-3172646 CTTGTACCAGGAGTGGCTCTTGG - Intronic
1091807739 12:3367755-3367777 CCTCTGGAAGCTGTGGCTCTGGG - Intergenic
1095206632 12:39445827-39445849 CCAATAACAGCTGTGGCTTTGGG + Intergenic
1095907558 12:47393447-47393469 CCTCTAACAGATGTAGCACTTGG - Intergenic
1099927974 12:89041103-89041125 CCACCACCAGCAGAGGCTCTAGG - Intergenic
1100074507 12:90763341-90763363 CCTCAAATAGGAGTGGCTCTAGG + Intergenic
1101369302 12:104110935-104110957 ACTTTTACAGCAGTTGCTCTAGG + Intergenic
1103870125 12:124085424-124085446 CCTGGAACAGCCGTGGCACTAGG - Intronic
1106586446 13:31060804-31060826 CCTTTCACAGCCGTGGTTCTGGG + Intergenic
1107161157 13:37229719-37229741 TCTGTAACTGCAGTGGCTCTAGG + Intergenic
1107997131 13:45871976-45871998 TCCCCAACAGCCGTGGCTCTTGG - Intergenic
1111864174 13:93747237-93747259 CCACTATCAGCAGTGGCACCAGG + Intronic
1113600476 13:111564934-111564956 GCTCCAATAGCAGAGGCTCTTGG + Intergenic
1114310090 14:21458582-21458604 ACTCTGAAAGCAGTAGCTCTAGG + Intergenic
1114494142 14:23121019-23121041 CCTCTCACAGCGCTGGCTCTCGG + Intergenic
1116808487 14:49516590-49516612 CATTTAACAGCAGCAGCTCTTGG - Intergenic
1118444476 14:65838914-65838936 CCTCTGCCTGCAGTGGCTTTGGG + Intergenic
1118728850 14:68652442-68652464 CCTCCAACAGCACTAGCTGTGGG + Intronic
1119007637 14:70945977-70945999 CCTCTGCCAGTAGTGACTCTAGG + Intronic
1120758840 14:88268360-88268382 CCTCTAACTGGAGTGGGTGTTGG - Intronic
1121445905 14:93978748-93978770 CCTCTAACTGGAGGGACTCTTGG + Intergenic
1122684293 14:103492886-103492908 CCTGAAACTGCAGGGGCTCTTGG - Intronic
1124595256 15:31086592-31086614 CCTCTCCCAGCAGGGGCTCCAGG + Intronic
1125404294 15:39336719-39336741 CCTCCATGGGCAGTGGCTCTTGG - Intergenic
1128705260 15:69833564-69833586 CCTCTGAAAACACTGGCTCTAGG - Intergenic
1130355258 15:83123753-83123775 CCTTTAAAAGCAGTGGAGCTGGG - Intronic
1131643030 15:94313005-94313027 CCCCTACCCGCAGTGGCTCATGG + Intronic
1132883185 16:2171260-2171282 CCGCAAACACCAGTGGCTCCTGG - Exonic
1133188158 16:4115269-4115291 CCTCTAGCTGCAGCAGCTCTGGG - Exonic
1138738559 16:59280549-59280571 TCTATAGCAGAAGTGGCTCTTGG - Intergenic
1139441566 16:66970526-66970548 CATCTGACAGCTGAGGCTCTAGG - Intronic
1142566203 17:841750-841772 CCACTTCCAGCAGTGGCTCTGGG + Intronic
1142720741 17:1774157-1774179 ACTCCTACAGCAGTGTCTCTGGG - Intronic
1142972983 17:3625402-3625424 CCTCTTACACCAGTCTCTCTGGG + Intronic
1143691031 17:8566189-8566211 CCTGTAACTGGAGTGACTCTAGG - Intronic
1144821962 17:18081442-18081464 CCTTCTACATCAGTGGCTCTCGG - Intergenic
1144886455 17:18466339-18466361 CCTCTAAGTGCAGAGGCCCTGGG - Intergenic
1145145753 17:20477969-20477991 CCTCTAAGTGCAGAGGCCCTGGG + Intergenic
1146730875 17:35193312-35193334 CCTCTCACAGCTGAGGTTCTGGG + Exonic
1148103696 17:45108134-45108156 CTTCCAACAGCAGTTGCTCGAGG - Exonic
1148122127 17:45219478-45219500 CCTCTCACAGAAGTAGTTCTGGG + Intergenic
1149696316 17:58619113-58619135 CCTCTAGCAGCAGTGGAACTGGG + Intronic
1150631863 17:66885492-66885514 CCAATCACAGCAGTGGCTCCAGG + Intergenic
1151364272 17:73606966-73606988 CCTCAAGAAGCATTGGCTCTTGG - Intronic
1154124339 18:11676264-11676286 CTTCTTTCAGAAGTGGCTCTCGG - Intergenic
1154384403 18:13880232-13880254 CCTCTATCAGAAGTGCCTCTAGG - Intergenic
1154426127 18:14273638-14273660 CCTCTAACAGCAAGGGCTGCTGG - Intergenic
1154433815 18:14328875-14328897 CCTCTAACAGCAAGGGCTGCTGG - Intergenic
1157224778 18:45852922-45852944 CCTGCCACAGCAGTGGCTCTTGG - Intronic
1157606449 18:48928985-48929007 CCTCAGACAGCAGTGGCTGCAGG - Intronic
1160270008 18:77375182-77375204 CGCCTCACAGCAGTGTCTCTCGG + Intergenic
1161796712 19:6391248-6391270 CCTCTGATGGCAGGGGCTCTGGG + Intronic
1163605690 19:18274191-18274213 CCCCTCACAGCAGGGGCTCTAGG - Intronic
1163687648 19:18721044-18721066 CCTCCAGCTTCAGTGGCTCTAGG + Intronic
1163711292 19:18848647-18848669 CCTTTGACAGCTGTGGGTCTCGG + Intronic
1163846643 19:19641968-19641990 CCACTCACAACAGTGGCTGTAGG + Exonic
1164054424 19:21609831-21609853 ACTTTAACAGCAGTGGGACTAGG - Intergenic
1165672643 19:37692472-37692494 CCCCTGACAGCACTGGCTCTGGG - Intronic
1165763727 19:38337119-38337141 CCTCTCACAGCACTTGCTCCTGG - Intronic
1165942741 19:39423406-39423428 CCAGGATCAGCAGTGGCTCTGGG - Exonic
1167456954 19:49601486-49601508 CCTCCAGCAGCGGGGGCTCTGGG - Exonic
1168699797 19:58430811-58430833 CCTTCAAGAGCAGTGGCTATGGG - Intergenic
927488732 2:23506465-23506487 CCTACAGGAGCAGTGGCTCTTGG - Intronic
929479025 2:42284733-42284755 ACTCTAACAGCAATGTCTCTAGG - Intronic
935136863 2:100313105-100313127 CCTAGTACAACAGTGGCTCTGGG - Intronic
936327619 2:111519302-111519324 CCTCCACCAGCAGTTTCTCTAGG + Intergenic
941843431 2:170111212-170111234 CCTCTACCAGCTGTGGCACCTGG - Intergenic
945922580 2:215770755-215770777 CCACCAGCAGCAGTGGCTCATGG - Intergenic
946050116 2:216855467-216855489 CCTCTAGGAGCAGTGGGCCTTGG - Intergenic
947461946 2:230311033-230311055 TCTCTAACATGTGTGGCTCTTGG - Intronic
947471030 2:230401245-230401267 TCTCTAACATGTGTGGCTCTTGG - Intronic
948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG + Intergenic
948943656 2:241208703-241208725 CCTCTTACAGCATTAACTCTAGG + Intronic
1172978949 20:38926763-38926785 GCTCCAACAGCGGTGGCTCCAGG - Exonic
1173092847 20:39991733-39991755 CCTATAACTTCAGTGGCACTGGG - Intergenic
1173374441 20:42470834-42470856 GTTCTAGCAGTAGTGGCTCTAGG + Intronic
1173926905 20:46787551-46787573 CCTGTAAAAGGAGAGGCTCTTGG - Intergenic
1174041817 20:47705563-47705585 CTCCTCAAAGCAGTGGCTCTTGG + Intronic
1175150748 20:56931993-56932015 CCTCCAACAGCACTGGGACTGGG + Intergenic
1175687412 20:61041614-61041636 CCTCCAACAGCAGTGGCAAATGG + Intergenic
1176041076 20:63066185-63066207 CCTCTAACTGCAGGGACGCTGGG + Intergenic
1181271352 22:21660676-21660698 CCCCTGTCAGCAGTGGCTCTAGG + Intronic
1183254080 22:36749634-36749656 CCTCCAACAGCACAGGCTGTAGG + Intergenic
1183908715 22:41062450-41062472 TCTCTATCAGCAGTGGCTGGAGG + Intergenic
1183927685 22:41217592-41217614 CCTTTTACAGAAGTGGCTCCAGG - Intronic
949642005 3:6046786-6046808 CCTGTAGCAGCTGTGGCACTAGG - Intergenic
950678799 3:14570758-14570780 CCGGTAAAAGCAGTGCCTCTTGG - Intergenic
953349634 3:42205738-42205760 CCTCTGACATCAGTGGATTTTGG + Intronic
954100583 3:48369625-48369647 CAGCTAAGAGCACTGGCTCTGGG + Intergenic
957080380 3:75631660-75631682 CCTCTACCATCAGTGGTGCTGGG - Intergenic
959619669 3:108386419-108386441 CCTCCAACTGCAGTGCCTTTGGG + Intronic
961414360 3:126746477-126746499 CCCCTGGCAGCAGTGGCGCTTGG + Intronic
961660984 3:128468678-128468700 CCTCTAACTGCATTAGCTCCAGG + Intergenic
961779067 3:129310963-129310985 GCCCTAACAGCAGTTGCTGTGGG + Intergenic
962250791 3:133834815-133834837 CCTCTCACAGCATTGGGTCTGGG + Intronic
962327833 3:134450440-134450462 CCTGTAAAAGCAGTGGAGCTTGG - Intergenic
964733189 3:159889440-159889462 CCTCTAACAGAAGTGGCCACAGG + Intronic
969700059 4:8762987-8763009 CCACCCACAGCAGAGGCTCTGGG + Intergenic
969842999 4:9897293-9897315 CCTCCAACAGCACTGGCACTGGG + Intronic
969934213 4:10665333-10665355 CCTCTTACAGAAGAGGCCCTTGG + Intronic
974323140 4:60378419-60378441 CTTCTATGAGCTGTGGCTCTGGG + Intergenic
977959600 4:103071073-103071095 CCTTTAACAGCAGTTGCCTTTGG + Intronic
982397461 4:154927542-154927564 CCTCTAACTGCAGTGTCTCCAGG - Intergenic
985391930 4:189498905-189498927 CCACAAACAGCATTCGCTCTTGG - Intergenic
985561596 5:589631-589653 ACTCTCACATCACTGGCTCTAGG - Intergenic
985861820 5:2477376-2477398 CCTCCAACAGCAGCGGCAGTGGG + Intergenic
986193062 5:5514655-5514677 CCTCGAGCAGCAGTGGCTTTTGG - Intergenic
989668519 5:43886679-43886701 TTTCCAACAGCAGTGACTCTAGG - Intergenic
990304391 5:54480519-54480541 ACTCCAACAGCTGTGGTTCTAGG - Intergenic
990983473 5:61621563-61621585 CATCTGGCAGCAGTGTCTCTGGG - Intergenic
994061737 5:95486255-95486277 GCTCCAGCAGCAGTGGCTGTGGG - Intronic
994182592 5:96784085-96784107 CCACTAACCACAGTGTCTCTTGG - Intronic
994312258 5:98287268-98287290 CCTCCAACACTAGTGTCTCTAGG + Intergenic
994570199 5:101505600-101505622 CCTCTCACATCAGTGTGTCTTGG + Intergenic
995031303 5:107484602-107484624 ACTCTAAGAGCACTGGCACTGGG + Intronic
998977839 5:147667968-147667990 CCTCCACCAGCTGTGTCTCTTGG + Intronic
999144896 5:149385864-149385886 CCTCTGCCAGGAGCGGCTCTGGG - Intronic
999708086 5:154292280-154292302 CCTCTAGAAGCAGAAGCTCTGGG - Intronic
1004016183 6:11733876-11733898 CCAATAACAGCAGTGGCCTTAGG + Intronic
1010499981 6:76586063-76586085 CCTATAACAGCAGTTCCTATAGG - Intergenic
1019350926 7:553596-553618 CCTCTGAGAGCAGCTGCTCTTGG + Intronic
1023904534 7:44512946-44512968 CCTCCCACAGCGTTGGCTCTTGG + Exonic
1024322641 7:48086154-48086176 CCTCTAGCAGCTGCTGCTCTAGG + Intergenic
1032534782 7:132653674-132653696 TCTCTAAGAGCAGTGACTATAGG + Intronic
1032671459 7:134086598-134086620 CCTCTCAAGGCAGTGGTTCTGGG + Intergenic
1035658472 8:1329714-1329736 CTTCTAACAGCAGAGACCCTGGG + Intergenic
1036754101 8:11461149-11461171 CCTCTCCCTGCAGTGGCCCTGGG - Intronic
1037842725 8:22256627-22256649 CCGCTAACAGCAGGGGCACTGGG + Intergenic
1038520856 8:28230838-28230860 CCCCTGGCAGCAGTGGATCTGGG - Intergenic
1038581225 8:28750968-28750990 CCCCTTCCAGCAGAGGCTCTGGG - Exonic
1039363440 8:36904677-36904699 CCTCTAACTGCCTTGGCTCAGGG - Intronic
1041604746 8:59768382-59768404 CCTATAACAGTACTGGGTCTTGG - Intergenic
1043424906 8:80138952-80138974 CCACTAGCAGGAGAGGCTCTGGG - Intronic
1043649971 8:82578956-82578978 CCTGTATCAGCAGTGGCTGCAGG - Intergenic
1044090151 8:87990109-87990131 CCTCTTACAGCTGTGGCAGTGGG + Intergenic
1045290023 8:100825077-100825099 CCTCTAAGGGCAGTGGCTCTTGG + Intergenic
1046706792 8:117462886-117462908 CCTCTAATAGCATTGGCACGTGG - Intergenic
1049247213 8:141569255-141569277 TCTCTAAGAGCAGAGGCTGTAGG + Intergenic
1051906590 9:22102471-22102493 GCCCTACCAGCAGAGGCTCTTGG - Intergenic
1053754746 9:41294060-41294082 CATCTAACAGCAGTTGCTGAGGG - Intergenic
1054576895 9:66868803-66868825 CCTCTAGCAGGCGTAGCTCTGGG + Intronic
1055030805 9:71769670-71769692 GCTCTCACAGCCTTGGCTCTGGG + Intronic
1055114216 9:72589732-72589754 ATTCTAACAGCATTGGCTGTGGG + Intronic
1055662557 9:78519881-78519903 CCCTCAACAGCAGTGGCTATGGG - Intergenic
1057805524 9:98217109-98217131 CCTGGAACAGCAGTGGCAGTGGG + Intronic
1189427227 X:40912358-40912380 CAGCTGCCAGCAGTGGCTCTGGG - Intergenic
1190161846 X:48037614-48037636 GCCCACACAGCAGTGGCTCTAGG + Intronic
1191242776 X:58202412-58202434 CCTCGAACAGGAGAGGCTCCTGG + Intergenic
1191243499 X:58207695-58207717 CCTCTTACAGCAGAGACTCCTGG + Intergenic
1191248666 X:58247993-58248015 ACTCTAACAGGAGGGGCTCCTGG + Intergenic
1195146930 X:102027275-102027297 GCACTAACAGCAGTGGCAATAGG - Intergenic
1198767802 X:140096029-140096051 CTTCCAACAGCAGTATCTCTTGG + Intergenic
1199177710 X:144811083-144811105 CAACTAACAGAAGTGCCTCTGGG + Intergenic
1199768118 X:150955079-150955101 CCACTAACATCAGTGTCACTGGG + Intergenic
1199976406 X:152897411-152897433 CATCAAACCGCATTGGCTCTGGG + Intergenic