ID: 1075216313

View in Genome Browser
Species Human (GRCh38)
Location 10:120539252-120539274
Sequence TGTTAGAGGCAGAAGGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216304_1075216313 -3 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216306_1075216313 -8 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216303_1075216313 -2 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG 0: 1
1: 0
2: 3
3: 72
4: 311
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216307_1075216313 -9 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG 0: 1
1: 0
2: 2
3: 17
4: 170
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data
1075216305_1075216313 -7 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216313 10:120539252-120539274 TGTTAGAGGCAGAAGGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216313 Original CRISPR TGTTAGAGGCAGAAGGGGTC AGG Intronic
No off target data available for this crispr