ID: 1075216314

View in Genome Browser
Species Human (GRCh38)
Location 10:120539258-120539280
Sequence AGGCAGAAGGGGTCAGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216303_1075216314 4 Left 1075216303 10:120539231-120539253 CCCGTCCCCTAGAGCCACTGCTG No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216306_1075216314 -2 Left 1075216306 10:120539237-120539259 CCCTAGAGCCACTGCTGTTAGAG No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216304_1075216314 3 Left 1075216304 10:120539232-120539254 CCGTCCCCTAGAGCCACTGCTGT No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216307_1075216314 -3 Left 1075216307 10:120539238-120539260 CCTAGAGCCACTGCTGTTAGAGG No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216309_1075216314 -10 Left 1075216309 10:120539245-120539267 CCACTGCTGTTAGAGGCAGAAGG No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data
1075216305_1075216314 -1 Left 1075216305 10:120539236-120539258 CCCCTAGAGCCACTGCTGTTAGA No data
Right 1075216314 10:120539258-120539280 AGGCAGAAGGGGTCAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216314 Original CRISPR AGGCAGAAGGGGTCAGGATA TGG Intronic