ID: 1075216710

View in Genome Browser
Species Human (GRCh38)
Location 10:120542826-120542848
Sequence CCATCTTTTGCCCCACAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075216710_1075216713 21 Left 1075216710 10:120542826-120542848 CCTGATTGTGGGGCAAAAGATGG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1075216713 10:120542870-120542892 TGTGCATTTGCAACATGTAGTGG No data
1075216710_1075216715 28 Left 1075216710 10:120542826-120542848 CCTGATTGTGGGGCAAAAGATGG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1075216715 10:120542877-120542899 TTGCAACATGTAGTGGGATGAGG No data
1075216710_1075216714 22 Left 1075216710 10:120542826-120542848 CCTGATTGTGGGGCAAAAGATGG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1075216714 10:120542871-120542893 GTGCATTTGCAACATGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075216710 Original CRISPR CCATCTTTTGCCCCACAATC AGG (reversed) Intronic
912230713 1:107789407-107789429 CCATCTTTTGTCCCAGCCTCAGG + Intronic
914718814 1:150272600-150272622 CCCCCTTTTGCCTCTCAATCTGG + Intronic
915001964 1:152601808-152601830 CTATATTCAGCCCCACAATCTGG + Intergenic
915703494 1:157820832-157820854 CCCTCTTTTCCCTCAAAATCAGG + Intergenic
919329310 1:196149042-196149064 CCTTCTCTTGCCTCACCATCTGG + Intergenic
920870511 1:209790528-209790550 CCTTCTTTTGTCTCTCAATCAGG + Exonic
923980180 1:239312732-239312754 CCATCTGTATCCCCACAAGCTGG + Intergenic
1064761186 10:18622703-18622725 CCATCTTTTTCCCCCCAAGGCGG - Intronic
1065976734 10:30848212-30848234 GCATCATTTGCCCCAAAATGCGG - Intronic
1067479504 10:46585746-46585768 CCATGTTCTGCACCACAGTCAGG - Exonic
1067615234 10:47756052-47756074 CCATGTTCTGCACCACAGTCAGG + Intergenic
1070578451 10:77698776-77698798 CCATTTTTTTCCCCCAAATCTGG - Intergenic
1071333697 10:84585112-84585134 TCATCTTTTCTCCCACTATCAGG + Intergenic
1074857467 10:117483865-117483887 CCACCCTGTGCCCCACAGTCAGG - Intergenic
1075216710 10:120542826-120542848 CCATCTTTTGCCCCACAATCAGG - Intronic
1078973900 11:16449131-16449153 CCACCCTATGCCCCACAATTTGG - Intronic
1079452932 11:20612915-20612937 GCATCTTTTGCCACAACATCTGG + Intronic
1079922428 11:26449352-26449374 CCACCTTTAGCACCAGAATCAGG + Intronic
1080191227 11:29551715-29551737 CCGTCTTTTCCCCCAGAATATGG + Intergenic
1082767070 11:57178820-57178842 CCATCTTGTCGCCCACCATCTGG + Intergenic
1083733934 11:64668947-64668969 CCATCCTGTGCCCCAGAATGGGG - Intronic
1088151058 11:106746002-106746024 CCATCTTTAGCCCCACTACCAGG + Intronic
1090313634 11:125765484-125765506 ACCTCTTTTACCCCACAACCAGG - Intergenic
1093273411 12:17094401-17094423 CCATCCTTTGCCCCAAACCCAGG - Intergenic
1094196522 12:27755752-27755774 CCATTTCTTTCCCCACAAGCTGG + Exonic
1096017703 12:48293571-48293593 CCATCTCTGTTCCCACAATCTGG + Intergenic
1098139517 12:67437478-67437500 CCATCTTGAGCCCCATATTCAGG + Intergenic
1099254841 12:80303097-80303119 CCATGTTTTCCTCCACATTCTGG + Intronic
1105781281 13:23706852-23706874 CCATCTTTTGCACCCCAATTCGG - Intergenic
1107688517 13:42928363-42928385 CCTTCGTTTGCCCCTCAAACAGG - Intronic
1107799894 13:44095825-44095847 CCTCCTTCTCCCCCACAATCTGG - Intergenic
1109172338 13:59112355-59112377 CCATCATTTTCCCCACAGTCTGG - Intergenic
1114449114 14:22813245-22813267 CGATCATGTTCCCCACAATCAGG + Exonic
1115692726 14:35861640-35861662 CCATCTTTTCCCTGACACTCAGG + Intronic
1118486131 14:66215904-66215926 CCATCTCTTCCCCCAAAGTCAGG - Intergenic
1119914736 14:78387330-78387352 CCATCTTCTGCCCTATAACCTGG - Intronic
1126270043 15:46805196-46805218 CCATCATTTTCCCCAGAATTAGG + Intergenic
1128692335 15:69734562-69734584 TCTTCATTTGCCCCACACTCGGG - Intergenic
1130456926 15:84120205-84120227 GCATCTTTTGCCCTATACTCTGG - Intergenic
1131375429 15:91919120-91919142 CCATCTAGTGACCCACAATGCGG - Intronic
1134034487 16:11019152-11019174 ACATCTTTTTCCCCACCTTCGGG - Intronic
1134800398 16:17079060-17079082 CTATGTTTTCCCCCACCATCTGG - Intergenic
1137595190 16:49718963-49718985 GCCTCTTTTACCCCAAAATCAGG + Intronic
1137685748 16:50385597-50385619 CCATCCTTTGCCCCTCCAGCTGG - Intergenic
1142202576 16:88768171-88768193 CCAGCTCTTGCCCCACCAGCTGG - Intronic
1142901968 17:3017848-3017870 CCATATTCTGCCCCACACTCTGG - Intronic
1145062222 17:19740375-19740397 CCACCTTCTGGCCCTCAATCAGG + Exonic
1148582098 17:48751354-48751376 CCAGCTCTTTCCCCACACTCTGG - Intergenic
1148691408 17:49529010-49529032 GAATCTTTTTCCCCACAATCTGG - Intergenic
1151537002 17:74744797-74744819 CCATATTTTGCCCCAGAAGCAGG - Intronic
1155232914 18:23792336-23792358 CCATGTTTTGCCCCAGTATGTGG - Intronic
1155243683 18:23886979-23887001 CCATCTTTTGCCATAGAATTGGG - Intronic
1159304100 18:66616729-66616751 CCACCTTGTGCCCCACAACCTGG + Intergenic
1160372258 18:78383609-78383631 CCATCTGTTGCTCCACATTCTGG + Intergenic
1161895929 19:7080297-7080319 CCTTCTTTTCCCCCACAAGATGG - Intronic
1162736034 19:12747649-12747671 TGATCTTTTGCTCCACCATCTGG + Intronic
1164846725 19:31438791-31438813 CCACCTGCTGCTCCACAATCAGG + Intergenic
1165984583 19:39756972-39756994 TCATCATATGACCCACAATCAGG - Intergenic
930314885 2:49785573-49785595 CCATCTTTTAACCCAAACTCAGG + Intergenic
930868617 2:56147537-56147559 TCTTCTTTGGCCCAACAATCAGG - Intergenic
944065392 2:195614670-195614692 CCATTTTCTCCCCCACAAACTGG + Intronic
944209160 2:197188422-197188444 TCCTCTTTTACCCCACACTCTGG - Intronic
946773036 2:223108948-223108970 CCATCATTTTCCCCAGAAACTGG + Intronic
1171849115 20:30295583-30295605 CCATTTTGTGCCCCACGATGGGG + Intergenic
1171945539 20:31373827-31373849 CCATCCTTTCACCCACAATTGGG - Exonic
1172162142 20:32876106-32876128 CCATCTTCAGCCCCACCAACTGG - Intronic
1175414499 20:58792842-58792864 CCATCTTCTCCCCCATCATCAGG + Intergenic
1175488904 20:59365445-59365467 CCTTCTCTTCCCCCACCATCAGG + Intergenic
1178777889 21:35569506-35569528 CCTTCTTTTCCCCCAGAATCTGG - Intronic
1183179108 22:36246692-36246714 CCATCTGCTGCCCCTCACTCTGG - Intergenic
951741058 3:25923804-25923826 TCACCTTTTGCCCAGCAATCTGG - Intergenic
953477776 3:43220709-43220731 CCATCATTTTCCCAAGAATCAGG - Intergenic
954365753 3:50145218-50145240 CCATCTTTGGCCCCCCCAGCAGG + Intergenic
955001457 3:54931293-54931315 CCATCTTTTAACCCCCAATTGGG - Intronic
960964931 3:123098067-123098089 CCATCTTTTGCCCCAGGTTCTGG + Intronic
968034427 3:195534398-195534420 GCATTTTTTTCCCCAGAATCAGG - Intronic
972741668 4:41893103-41893125 CCAACTTTTGCCCCTGAACCTGG + Intergenic
974085190 4:57252851-57252873 CATTCTTTTGCCCCACAGTTAGG - Intergenic
976221382 4:82759294-82759316 CCGTCTTTTTCCCCACCATGTGG + Intronic
979064201 4:116107227-116107249 CCATCTTATGCCACCCAATTAGG - Intergenic
981573361 4:146176754-146176776 CAATCTAATGTCCCACAATCGGG - Intronic
984164178 4:176287907-176287929 GCATCTTTTGACAGACAATCTGG - Intergenic
985545376 5:506418-506440 CCATCATTTGCCCCAAATGCAGG + Intronic
986451554 5:7869725-7869747 CCTGCTACTGCCCCACAATCCGG - Intronic
986644413 5:9902596-9902618 CAAACTTCTGCCCCACAAACTGG + Intergenic
992886961 5:81168721-81168743 CCTTCTTTTTCCCCTCAATTTGG + Intronic
997431872 5:133846574-133846596 CCATCACTAGCCCCAAAATCTGG + Intergenic
999610284 5:153361984-153362006 CACTCTTATGCCCCACAATCAGG + Intergenic
999649646 5:153752951-153752973 CCATCTTTAAGCCCACAATAGGG - Intronic
1001436072 5:171700332-171700354 CCATCTTTTGTTCCACACACAGG + Intergenic
1003206698 6:4019201-4019223 CCAACTTTAGTCACACAATCTGG + Intergenic
1003835155 6:10063365-10063387 CTATCTTTTCCCCCTCAAACTGG - Intronic
1004117953 6:12789636-12789658 CCATAATTTGCCCCACCCTCAGG + Intronic
1011755943 6:90498290-90498312 CCTTCTTTTTCCAAACAATCAGG - Intergenic
1012373739 6:98536916-98536938 CCTTCTTTTGCCCCACATCTGGG + Intergenic
1014396596 6:120931432-120931454 CTTTCTTTTCCCCCACAATCTGG - Intergenic
1022785691 7:33634887-33634909 CCATCTCTAACCCCACACTCCGG - Intergenic
1026631567 7:72042353-72042375 CTAGATTTTGCCCCACACTCTGG - Intronic
1028869231 7:95748980-95749002 TCATCCTTTTCCCCAGAATCTGG - Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1032967878 7:137122244-137122266 CCAGCTTTTTCCCCGCAAGCAGG - Intergenic
1040837457 8:51747338-51747360 CCATCTTTGCCACCACCATCAGG + Intronic
1040893393 8:52340145-52340167 CCATCTTTTGGCACACAGCCAGG + Intronic
1041099149 8:54379197-54379219 CCATGTTTTCCCACAGAATCTGG + Intergenic
1043542653 8:81280751-81280773 GCATCTCCTGCCCCAGAATCTGG - Intronic
1043734147 8:83723624-83723646 CCATCTTGTCACCCACAATGTGG + Intergenic
1045654429 8:104372492-104372514 GCAACTTCTGCCCCACAATCAGG + Intronic
1045993148 8:108333763-108333785 CCATCTTTTCCTACACCATCAGG + Intronic
1051395442 9:16615412-16615434 CCATCCTTTTCCCCAGAAGCAGG + Intronic
1054744557 9:68841553-68841575 CCATCTTTCGTCCCACAGTTTGG + Intronic
1057468636 9:95338284-95338306 CCTTCTCTTCCCCCACAATGTGG - Intergenic
1059177146 9:112177414-112177436 CCATCTATTGCTCCCCAAACAGG - Intergenic
1186550804 X:10503194-10503216 CTAACTTTTGCCCCAGAGTCTGG - Intronic
1186625962 X:11294180-11294202 ACATCTTTTGCTCCACAATCTGG + Intronic
1195127579 X:101823161-101823183 CCTTCTTTTGGCCCACAACATGG - Intergenic
1195196773 X:102504741-102504763 CCAACTCCTGCCCCACAACCAGG - Intergenic
1195531153 X:105959730-105959752 CCATCTTCTGCCTCACACGCTGG - Intergenic
1196340345 X:114587550-114587572 CCATCTGTTTCACAACAATCAGG - Intronic
1196653962 X:118197675-118197697 CCATTTTTAGCCCCACTTTCAGG + Intergenic
1200217948 X:154376808-154376830 CACCCCTTTGCCCCACAATCAGG - Intergenic