ID: 1075218013

View in Genome Browser
Species Human (GRCh38)
Location 10:120555590-120555612
Sequence ATACAGTAAGGTGTTTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075218013_1075218015 -10 Left 1075218013 10:120555590-120555612 CCTTGGCAAACACCTTACTGTAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1075218015 10:120555603-120555625 CTTACTGTATCAACACACACTGG No data
1075218013_1075218019 23 Left 1075218013 10:120555590-120555612 CCTTGGCAAACACCTTACTGTAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1075218019 10:120555636-120555658 AGAAAGAGCACGGGTCTGCCTGG No data
1075218013_1075218016 -9 Left 1075218013 10:120555590-120555612 CCTTGGCAAACACCTTACTGTAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1075218016 10:120555604-120555626 TTACTGTATCAACACACACTGGG No data
1075218013_1075218017 13 Left 1075218013 10:120555590-120555612 CCTTGGCAAACACCTTACTGTAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG No data
1075218013_1075218018 14 Left 1075218013 10:120555590-120555612 CCTTGGCAAACACCTTACTGTAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1075218018 10:120555627-120555649 TGCAGAGACAGAAAGAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075218013 Original CRISPR ATACAGTAAGGTGTTTGCCA AGG (reversed) Intronic
906761086 1:48379439-48379461 AAACAGAATGGTGGTTGCCAGGG + Intronic
906871083 1:49481736-49481758 ATTCAGTATGGTGTTGGCCGTGG + Intronic
907873833 1:58466654-58466676 AGACAGGAGGGTGTTTGGCAGGG - Intronic
908567659 1:65374891-65374913 ATTCAGTACGATGTTAGCCATGG + Intronic
909089220 1:71205069-71205091 ATACAGTAAGTGCTATGCCATGG - Intergenic
909619473 1:77651552-77651574 AAACAGAATGGTGGTTGCCAGGG + Intronic
912686573 1:111772385-111772407 GTACAGTCAGGTGATTTCCAAGG + Intronic
912857392 1:113182216-113182238 ATTCAGTATGATGTTGGCCATGG - Intergenic
913205951 1:116538921-116538943 GTACAGTATGGTGTTTAGCATGG + Intronic
915463972 1:156085163-156085185 ATGCAGTTAGGTGTGTGGCATGG + Intronic
915779499 1:158530886-158530908 ATTCAGTATGATGTTGGCCATGG - Intergenic
916197951 1:162242572-162242594 TTACAGTAAGATGTTGGCTAGGG - Intronic
916901956 1:169235424-169235446 ATGCAGTAAGGTGGTTGTGAGGG - Intronic
917085613 1:171302882-171302904 ATTCAGTATGATGTTAGCCATGG - Intergenic
917129356 1:171725100-171725122 AAATAGAATGGTGTTTGCCAGGG - Intronic
919432295 1:197510852-197510874 ATGGAGGGAGGTGTTTGCCATGG + Intronic
920614975 1:207483044-207483066 ATACCGTCAGGTGTTGGCCTCGG + Intronic
920615664 1:207490449-207490471 AAACAGAATGGTGGTTGCCAGGG - Intergenic
922971437 1:229744101-229744123 ACATAGTAAGGTGTTGGCTATGG + Intergenic
1063013597 10:2051321-2051343 AAGCAGTGAGGTGGTTGCCAAGG + Intergenic
1063074928 10:2705472-2705494 AAATAGAATGGTGTTTGCCAGGG - Intergenic
1068369115 10:56091025-56091047 ATACAGGAAGCAGTGTGCCAAGG - Intergenic
1069947365 10:71997229-71997251 AGACAGAAGGGTGTCTGCCAGGG - Intronic
1070060335 10:72976536-72976558 ATTCAGTAAGATGTTAGCCATGG + Intergenic
1071064608 10:81615816-81615838 ATGCAGAAAGGATTTTGCCATGG + Intergenic
1071171560 10:82870730-82870752 CTTTAGTAAGGTGTCTGCCAAGG + Intronic
1072534295 10:96349411-96349433 GTACAGACATGTGTTTGCCATGG + Intronic
1073273675 10:102289285-102289307 ATAGAGTAAGGTATGTACCAAGG - Intronic
1074470788 10:113724858-113724880 ATATAGAACGGTGGTTGCCAGGG - Intronic
1075218013 10:120555590-120555612 ATACAGTAAGGTGTTTGCCAAGG - Intronic
1077399812 11:2349102-2349124 ATGCAGTCAAGTGTTTGCTAAGG - Intergenic
1077942535 11:6858818-6858840 ATACAGTAAAGCCTTTTCCATGG - Intergenic
1079419490 11:20272718-20272740 AGACAGTAAGTTCTTTGCCCTGG + Intergenic
1081107415 11:39087739-39087761 ATACAGTAAGGAGTGGGCCAAGG - Intergenic
1082651054 11:55794049-55794071 ATACAGCAAGGTATGGGCCACGG + Intergenic
1083541939 11:63517586-63517608 ATACAGTAATATATGTGCCATGG + Intergenic
1085441710 11:76570001-76570023 ATGCAATCAAGTGTTTGCCAGGG - Intergenic
1086216615 11:84390390-84390412 GTACAGTAAAGTGTCTGGCATGG - Intronic
1088934451 11:114384934-114384956 TTGCAGTAAGATGTTGGCCAGGG - Intergenic
1090810001 11:130230106-130230128 ATACAGTAATGTATTTTTCAAGG + Exonic
1092506259 12:9103585-9103607 AAACAGGATGGTGGTTGCCAAGG - Intronic
1092513978 12:9188402-9188424 ATTCAGTATGATGTTGGCCATGG - Intronic
1093875938 12:24349449-24349471 AGACAGAATGGTGGTTGCCAGGG - Intergenic
1093995816 12:25641364-25641386 ATACAGTAAGCTACATGCCATGG + Intronic
1094468399 12:30779133-30779155 ATACATTCAGATGGTTGCCAGGG + Intergenic
1094732432 12:33193558-33193580 ATTCAGTATGATGTTAGCCATGG + Intergenic
1097957901 12:65505581-65505603 ACTCAGGAAGGTATTTGCCAAGG - Intergenic
1098409555 12:70166193-70166215 AAACAGTAAGGTATTAGCCTAGG + Intergenic
1098941742 12:76545009-76545031 AGAGAGTAAGTGGTTTGCCAAGG + Intronic
1101152824 12:101899014-101899036 AAACAATCAAGTGTTTGCCAAGG + Intronic
1101299484 12:103463752-103463774 ACACAGGAAGGTGTCTGTCAGGG - Intronic
1104247769 12:127060190-127060212 ATAGAGGAAGGTGTTTTCTAGGG - Intergenic
1106300154 13:28456818-28456840 ATAAGGATAGGTGTTTGCCAGGG + Intronic
1107543487 13:41415435-41415457 AAACAGTGTGGTATTTGCCAAGG - Intergenic
1108487495 13:50941734-50941756 TTACAGTAGGCTGTTTGCCCAGG + Intronic
1111457539 13:88504576-88504598 ATTCAGTATGATGTTGGCCATGG + Intergenic
1111474755 13:88729564-88729586 ATCCAGTAAGGTCTTTCTCAAGG + Intergenic
1111476094 13:88749960-88749982 ATACAGTATTCTGTTTGTCAAGG + Intergenic
1112724541 13:102287748-102287770 ATAAAGTAAGGGGTTTAGCATGG - Intronic
1113244551 13:108379862-108379884 ATACAGTAATTAGTTTGCTAAGG + Intergenic
1115712658 14:36067793-36067815 ATACAGTCTGTAGTTTGCCAAGG - Intergenic
1115782574 14:36786058-36786080 ATACACTAGGGTGCTTCCCAAGG - Intronic
1117284409 14:54272742-54272764 ATAGAGTCAGACGTTTGCCAGGG - Intergenic
1117334585 14:54746026-54746048 ATTCTGTAAGCTGTTGGCCAGGG - Intronic
1117902323 14:60548049-60548071 ATTCAGTAAGATGTTAGCTATGG + Intergenic
1121202057 14:92126412-92126434 GTACAGTAAGCTTTTTGACAGGG + Intronic
1123134714 14:106017088-106017110 ATTCAGTATGATGTTGGCCATGG + Intergenic
1124995717 15:34721487-34721509 AAATAGAAAGGTGTTTGCAAGGG - Intergenic
1126504406 15:49387509-49387531 ATTCAGTAAGATGTTGGCTATGG - Intronic
1128007187 15:64254197-64254219 AGACAGAATGGTGGTTGCCAAGG + Intronic
1128461848 15:67875603-67875625 ACATAGTAAAGTGGTTGCCAAGG + Intergenic
1128805023 15:70524335-70524357 ATCCAGTTAGGTGTCTGCAAAGG + Intergenic
1130612374 15:85372895-85372917 ATATATTAATGTGTTTTCCAAGG + Intergenic
1134600268 16:15528446-15528468 ATTCTGGAAGGTGTTTGCTATGG - Intronic
1134841116 16:17402626-17402648 TTCCATTTAGGTGTTTGCCATGG - Intronic
1140153143 16:72392875-72392897 ATACAGTGAAGAGTTTTCCAGGG + Intergenic
1140653785 16:77118456-77118478 AAACAGAACGGTGGTTGCCAAGG - Intergenic
1142382950 16:89744275-89744297 ACAAAGTAAGGTGTTCTCCAAGG + Intronic
1144321504 17:14125976-14125998 CTCCATTAAAGTGTTTGCCACGG + Intronic
1146183460 17:30710775-30710797 GTACAGTGAGGTGCTGGCCAGGG - Intergenic
1146906134 17:36619067-36619089 ACAGAGAATGGTGTTTGCCAAGG - Intergenic
1149510377 17:57236367-57236389 AGACAGAATGGTGTCTGCCAGGG - Intergenic
1152001037 17:77645474-77645496 AGTCATTACGGTGTTTGCCATGG + Intergenic
1153453047 18:5250883-5250905 ATATAATAAAGTGTTTGCCTAGG - Intergenic
1155383918 18:25256227-25256249 ACACAGAATGGTATTTGCCAGGG + Intronic
1155854055 18:30809987-30810009 ATAGAGTTAGGTGGTTTCCAGGG - Intergenic
1157693944 18:49705748-49705770 AAACAGAACGGTGGTTGCCAGGG - Intergenic
1158129530 18:54137588-54137610 AAACAGAATGGTGATTGCCAGGG - Intergenic
1158626266 18:59074148-59074170 AAACAGATAGGTGATTGCCAAGG - Intergenic
1158962705 18:62599683-62599705 AAACAGAATGGTGGTTGCCATGG - Intergenic
1162975331 19:14204985-14205007 GTACAGTGAGGTGTTGGCCAGGG + Intronic
1163275744 19:16283197-16283219 AAACAGATTGGTGTTTGCCAGGG + Intergenic
1165646240 19:37440387-37440409 ATGCAGAATGGTGTTTGCCAGGG + Intronic
1165791905 19:38497563-38497585 ATCCAGTAAAGTGTTTGTAAAGG + Intronic
1166576865 19:43849658-43849680 TGACAGTATGGTATTTGCCATGG - Exonic
1167727754 19:51229001-51229023 ATTCAGTATGATGTTAGCCATGG + Intronic
925842050 2:8001660-8001682 ACACAGTAAGTTATTTACCATGG - Intergenic
926501550 2:13659844-13659866 ATTCAGTATGATGTTGGCCATGG + Intergenic
928779133 2:34799974-34799996 TTAAAGTAAGTTGATTGCCAGGG + Intergenic
930783336 2:55245557-55245579 AAACAGAAAGGTGGTTGCCAAGG + Intronic
930795217 2:55382695-55382717 AGACAAAAAGGTGTTTGCTACGG + Intronic
932078648 2:68690870-68690892 GTACAATGAGGTGTTTGACAGGG + Intronic
935432674 2:102993219-102993241 AGTCAGTGAGGTGTCTGCCATGG + Intergenic
936492928 2:112989580-112989602 ATTCAGTATGATGTTAGCCATGG + Intergenic
936562092 2:113548809-113548831 AAACTGTAAGCTGTTTACCAAGG - Intergenic
936830923 2:116645401-116645423 ATTCATTAATGAGTTTGCCACGG - Intergenic
937351403 2:121165626-121165648 ATGAAGTATGGTGTTTGCTATGG + Intergenic
937402968 2:121601232-121601254 ATTCAGTCAGATGTTAGCCATGG - Intronic
940945642 2:159615381-159615403 ATACAGTAAGGTCTGTGCCTTGG - Intronic
944509939 2:200454583-200454605 AAACTGTAAAGTCTTTGCCATGG + Intronic
945759362 2:213894471-213894493 ATTCAGTAAAGTGTTAGCTATGG - Intronic
946618988 2:221540761-221540783 AAACAGTAAGGTCTATGTCATGG - Intronic
947934532 2:233992641-233992663 AGCCAGCTAGGTGTTTGCCAGGG + Intronic
1169088940 20:2845787-2845809 AAACAGAATGGTGGTTGCCATGG - Intronic
1169472437 20:5898744-5898766 ATTAAGTATGGTGTTAGCCATGG - Intergenic
1173022604 20:39279818-39279840 ATACAGCAAGATGTTCACCATGG - Intergenic
1174596981 20:51692062-51692084 AAACAGAAAGATGCTTGCCAGGG + Intronic
1174986780 20:55463177-55463199 AAACAGAATAGTGTTTGCCAAGG - Intergenic
1175657875 20:60787432-60787454 ATACAGAGAGGGGTTTGGCATGG - Intergenic
1176786316 21:13260309-13260331 ATTCAGTAAGATGTTGGCTATGG + Intergenic
1178272719 21:31207598-31207620 TTACAATAAGGTGTTTTCCAAGG + Intronic
1179276718 21:39898609-39898631 ATATAGTAAGCTGTTTGGGATGG - Intronic
1181328284 22:22068463-22068485 AAACAGGGAGGTGTCTGCCATGG - Intergenic
1182409383 22:30170270-30170292 ATACAGTGAGTTGTGTGCCTGGG - Intronic
1183757117 22:39778638-39778660 ATTCAGTAAGGTGTTTCCAAAGG - Intronic
1184625174 22:45721549-45721571 ATAGATTAAGGTATTTGCCCTGG - Intronic
1184926573 22:47645347-47645369 AAACAGAATGGTGGTTGCCAGGG - Intergenic
1185037473 22:48487222-48487244 ACACAGCAAGGTGTGTGCCAGGG - Intergenic
949911403 3:8911818-8911840 AAACAGTAATGTGTTAGCCCTGG + Intronic
950319585 3:12037801-12037823 ATATGGTAAGGTATTTGCTATGG - Intronic
950790238 3:15465785-15465807 AAACAGAACGGTTTTTGCCATGG + Intronic
952143640 3:30507028-30507050 ATTCAGTATGATGTTAGCCATGG - Intergenic
952303481 3:32125025-32125047 ATACAGTAATTTTTTTGGCAAGG - Intronic
952440260 3:33320228-33320250 AAACAGTAAGGTATTTGGCATGG + Intronic
953528872 3:43720306-43720328 ATACAGGAAGGTTTTTGCACAGG + Intronic
955998744 3:64705994-64706016 ATGCAGATTGGTGTTTGCCAGGG - Intergenic
956419624 3:69073521-69073543 ATACAGAAAGGTGTTTGCATTGG - Intronic
958455257 3:94323141-94323163 ATTCATTAACGAGTTTGCCAAGG - Intergenic
958586106 3:96090235-96090257 AAACACTAAGGTGTTGGCAAAGG - Intergenic
959453347 3:106530038-106530060 ATGCAAAAAGGTCTTTGCCATGG - Intergenic
961120996 3:124369790-124369812 AGAGAGTAAGGTGGTTACCAGGG - Intronic
961392322 3:126559623-126559645 ATACAGTATGGTGTTGGCTGTGG + Intergenic
963464797 3:145665563-145665585 AGACAGTAAGATGTCTGTCAAGG + Intergenic
964611124 3:158616401-158616423 ATTCAGTAAGATGTTAGCTATGG + Intergenic
964999370 3:162933120-162933142 GAACAGAAAGGTGATTGCCAGGG - Intergenic
966713781 3:182995562-182995584 ATACAGTATGATGTTGGCTATGG + Intergenic
968688632 4:1978188-1978210 ATAGAGAAAAGTGTTGGCCATGG + Intronic
969832251 4:9807250-9807272 ACACAGCATGGTGTGTGCCAGGG - Intronic
971172074 4:24243594-24243616 AAAGAGTAGGGTTTTTGCCAAGG + Intergenic
972832361 4:42829238-42829260 ATTCATTAATGAGTTTGCCAAGG - Intergenic
975216215 4:71758956-71758978 AAATAGAAAGGTGGTTGCCAAGG - Intronic
975606567 4:76160815-76160837 ATACAGTAACATATTTGGCAAGG + Exonic
975992384 4:80270045-80270067 GTAAACTAAGGTGTTGGCCATGG + Intronic
980193705 4:129560212-129560234 AAACAGTATGGTGGTTACCAGGG - Intergenic
980305773 4:131059858-131059880 TTACAGTAAGGTGTTGGTGAAGG + Intergenic
980870553 4:138606860-138606882 ATACAGGAAGTTGTTTGGGATGG - Intergenic
981838827 4:149087360-149087382 ATACAGTATGGTGTCTGATAAGG - Intergenic
982038236 4:151368417-151368439 AAATAGCATGGTGTTTGCCAGGG + Intergenic
982428675 4:155297308-155297330 ATACAGTAAGGTGTATTCCTTGG + Intergenic
982524640 4:156462421-156462443 ATTCAGTAAGATGTTAGGCATGG + Intergenic
984104316 4:175526083-175526105 AGAGAGAAAGGTGTTTTCCAGGG - Intergenic
984946439 4:184972218-184972240 AAACAGAAAGGTGGTTGCCAGGG - Intergenic
986754246 5:10820073-10820095 ATTCAGTATGATGTTGGCCATGG + Intergenic
986763118 5:10897942-10897964 ATACAGCAAGGTGATGGCCTTGG + Intergenic
987799843 5:22680211-22680233 AAAGAGTAAGCTGTTTACCAAGG - Intronic
988081190 5:26416954-26416976 ATACAGGAACCTGTCTGCCATGG + Intergenic
988097744 5:26639167-26639189 ATTCAGTATGATGTTGGCCATGG + Intergenic
988158027 5:27479663-27479685 ATACAGTAAAGGGTCTACCATGG - Intergenic
988294129 5:29332923-29332945 ATATAGAAAAATGTTTGCCATGG + Intergenic
988736997 5:34032611-34032633 ATACAGACGGGTTTTTGCCATGG - Intronic
990323661 5:54653478-54653500 ATACAGTAATATGTTTCCTAAGG + Intergenic
993338696 5:86694170-86694192 ATTCATTAAGTGGTTTGCCAAGG - Intergenic
995194320 5:109346723-109346745 AAACAGAATGGTGGTTGCCAGGG + Intronic
995259034 5:110080360-110080382 AAACAGAATGGTGGTTGCCAGGG + Intergenic
998229965 5:140354855-140354877 AAACATTAAGCAGTTTGCCATGG - Intergenic
998417189 5:141954766-141954788 AGACAGTAAGGAATTTGCCTAGG + Intronic
998552029 5:143087029-143087051 AAGCACTAAAGTGTTTGCCAGGG + Intronic
998608352 5:143660585-143660607 TTGCAGTAGTGTGTTTGCCAGGG - Intergenic
998868467 5:146529552-146529574 TGAGAGTGAGGTGTTTGCCAGGG - Intergenic
999681188 5:154061810-154061832 ATACGTTAAGGTATTTGCAAGGG - Intronic
1000168835 5:158681704-158681726 GTACAGCAAGGTGATTGGCAGGG - Intergenic
1000641099 5:163702686-163702708 AAAAAGTAAAGTGTTGGCCAAGG - Intergenic
1001251431 5:170149848-170149870 ATATAGTAAGGTTTTAGCCCTGG + Intergenic
1001301468 5:170536757-170536779 ATACATAAGGCTGTTTGCCAAGG - Intronic
1001772859 5:174308962-174308984 ATGCAGGTAGGTGTCTGCCAGGG - Intergenic
1002444194 5:179279180-179279202 ACACTGTCAGGTGTGTGCCAAGG + Intronic
1002870571 6:1163793-1163815 AGACAGTAGGATGTTTTCCAGGG + Intergenic
1004786068 6:18968570-18968592 AAAAGGTAAGGTGGTTGCCAGGG + Intergenic
1005520880 6:26599239-26599261 AAACAGTAAGGTGGGTGGCAGGG - Exonic
1007122249 6:39392461-39392483 ATACTTTAAGGTCTTTGCCTTGG - Intronic
1009704884 6:67237251-67237273 ATTCAATAAGGTGTGTGTCAGGG - Intergenic
1010096759 6:72055618-72055640 ATTCAGTATGATGTTGGCCATGG + Intronic
1012879245 6:104765536-104765558 ATTCAGTGAGGAATTTGCCAAGG - Intronic
1017287361 6:152691360-152691382 AGACAGAATGGTGGTTGCCAGGG - Intergenic
1017500787 6:155020908-155020930 AGACAGGAAGGTGGTTGCCAGGG - Intronic
1017872478 6:158498823-158498845 ATACATCAACGTGTTTGTCACGG + Intronic
1018074094 6:160195190-160195212 ATTCAGTATGGTGTTTGCTATGG - Intronic
1019954017 7:4398830-4398852 GAACAGTAATCTGTTTGCCACGG - Intergenic
1020195289 7:6033497-6033519 ATGCAGTAAAGTCCTTGCCATGG + Intronic
1021409832 7:20317784-20317806 ACAGAGTAAGGTGTTTGGAATGG + Intergenic
1023315848 7:38935549-38935571 AAATAGAATGGTGTTTGCCAGGG - Intergenic
1026258440 7:68733243-68733265 AAACAGTATGGTATTAGCCAAGG + Intergenic
1028029444 7:85891696-85891718 ATACAGTATGATGTTAGCTAAGG - Intergenic
1030614195 7:111721046-111721068 ATTCAGTATGGTGTTGGCTATGG - Intergenic
1031803672 7:126279930-126279952 ATTCAGTATGATGTTGGCCATGG + Intergenic
1033001971 7:137515331-137515353 ATACAGAAAAGTGCTTGCCCTGG - Intronic
1035844708 8:2850715-2850737 ATCCAGTGAGCTGTTTTCCAAGG - Intergenic
1035919064 8:3657022-3657044 ATACAGGAAAGTGTCTGCCAGGG + Intronic
1037653966 8:20867142-20867164 ATACAGTAAGCTGTTTCCCATGG - Intergenic
1038519968 8:28222962-28222984 ATTCAGTATGATGTTGGCCATGG + Intergenic
1039785023 8:40826957-40826979 ATACAGCATGCTGTCTGCCATGG - Intronic
1041456282 8:58064265-58064287 TTAGAGAAAGGTGTTTACCATGG - Intronic
1046188465 8:110756123-110756145 GTAAAGTAAGGTGTTTATCAAGG + Intergenic
1046487570 8:114907987-114908009 AAAGAGTAAGGTGATTGCCAAGG + Intergenic
1049890586 9:66518-66540 AAACTGTAAGCTGTTTACCAAGG + Intergenic
1051515600 9:17927077-17927099 ACATAGTATGGTGGTTGCCAGGG - Intergenic
1053089061 9:35256446-35256468 TTAAAGTATGCTGTTTGCCATGG + Intronic
1053732055 9:41067701-41067723 AAACTGTAAGCTGTTTACCAAGG + Intergenic
1054696402 9:68364016-68364038 AAACTGTAAGTTGTTTACCAAGG - Intronic
1055059710 9:72055969-72055991 CTACACTAAGGGCTTTGCCAGGG - Intronic
1055059763 9:72056679-72056701 CTACACTAAGGGCTTTGCCAGGG - Intronic
1055747227 9:79462324-79462346 AAGCAGAAAGGTGGTTGCCAGGG + Intergenic
1056083725 9:83123970-83123992 AAGTAGAAAGGTGTTTGCCAAGG - Intergenic
1056470483 9:86900875-86900897 ATACAGAATGGTGGTTGTCAGGG + Intergenic
1056703824 9:88934546-88934568 ACACAGCAAGGTGGTTCCCAGGG + Intergenic
1185689188 X:2139328-2139350 ACATGGTAAGGTGTTTGTCAAGG + Intergenic
1187494808 X:19785894-19785916 ACACAGAATGGTGGTTGCCAGGG + Intronic
1187803998 X:23098069-23098091 ATTCAGTACAGTGTTTGTCATGG - Intergenic
1187928612 X:24273706-24273728 AAACAGAATGGTGATTGCCAGGG - Intergenic
1189700612 X:43714381-43714403 ATAGTGGATGGTGTTTGCCATGG + Intronic
1192898220 X:75466982-75467004 ATACAGGTAAATGTTTGCCATGG - Intronic
1193098115 X:77576791-77576813 AAATAGAATGGTGTTTGCCAGGG - Intronic
1194862825 X:99025271-99025293 AAACAGAAAAGTGGTTGCCAGGG - Intergenic
1196164995 X:112529069-112529091 GTACAGGAAGGTGTTTCCCAAGG - Intergenic
1198237314 X:134747393-134747415 ATATAGCAGGGTGTTTCCCAGGG - Intronic
1199022790 X:142902149-142902171 ATACATTAAGGTATTGCCCAAGG - Intergenic
1199309314 X:146304457-146304479 ACACAGTAAGTTGCTTGCGATGG - Intergenic
1200482197 Y:3719867-3719889 TGACAGAAAGGTGGTTGCCAGGG - Intergenic