ID: 1075218014

View in Genome Browser
Species Human (GRCh38)
Location 10:120555602-120555624
Sequence CAGTGTGTGTTGATACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075218014_1075218017 1 Left 1075218014 10:120555602-120555624 CCTTACTGTATCAACACACACTG 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG No data
1075218014_1075218019 11 Left 1075218014 10:120555602-120555624 CCTTACTGTATCAACACACACTG 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1075218019 10:120555636-120555658 AGAAAGAGCACGGGTCTGCCTGG No data
1075218014_1075218018 2 Left 1075218014 10:120555602-120555624 CCTTACTGTATCAACACACACTG 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1075218018 10:120555627-120555649 TGCAGAGACAGAAAGAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075218014 Original CRISPR CAGTGTGTGTTGATACAGTA AGG (reversed) Intronic
900822231 1:4898635-4898657 CTGTGTGTGTTCCTACAGTGTGG - Intergenic
900908122 1:5575205-5575227 TGGTGTGTGATGATGCAGTAAGG - Intergenic
904856952 1:33505758-33505780 TAGTGTGTGGTGATAGAGTCTGG + Intergenic
906633392 1:47391141-47391163 GAGTGTGTGTTGAACCTGTAAGG + Intergenic
906833012 1:49053360-49053382 AAGTGTGTCTGGATACAGGAAGG + Intronic
907443092 1:54490416-54490438 CAATGGGTGGTGACACAGTACGG + Intergenic
907898091 1:58711649-58711671 GATTGTGTGTTTATAAAGTAAGG - Intergenic
908363531 1:63393819-63393841 CAGTGAATGTTAATACAGCAAGG - Intronic
908635367 1:66158004-66158026 CAGTTTGTGTTGATGAGGTATGG + Intronic
908828721 1:68158317-68158339 CAGTGTTTTTTGAAACACTAGGG - Intronic
908900986 1:68956250-68956272 GAGTGTGTGTTTATAGCGTACGG - Intergenic
914798891 1:150945367-150945389 CATTGTGTGTAGGTACAGAAAGG + Intronic
922172068 1:223164010-223164032 CTGTGTGTATGTATACAGTATGG - Intergenic
1065910974 10:30305188-30305210 CTTTGTGTGTTGATACTGGATGG - Intergenic
1068470835 10:57460850-57460872 CAGTGTGGATTGAGGCAGTAGGG + Intergenic
1074946594 10:118286073-118286095 CAGTGCGTGTTGTTACAGCGAGG - Intergenic
1075218014 10:120555602-120555624 CAGTGTGTGTTGATACAGTAAGG - Intronic
1077379194 11:2220761-2220783 CAGTGTGTGCAGAGACCGTATGG + Intergenic
1079876330 11:25861803-25861825 TAGTTTGCGTTAATACAGTATGG - Intergenic
1081417394 11:42832264-42832286 CAGTGAGCCTGGATACAGTATGG + Intergenic
1089165366 11:116471836-116471858 CAGATGGTTTTGATACAGTAGGG - Intergenic
1089541972 11:119194748-119194770 CAGTGAGAGTTGATAAAGGAAGG - Intronic
1092559701 12:9599314-9599336 CAGTGTGTGTTAATAAAAAAAGG - Intronic
1097894569 12:64811541-64811563 CAGGGTGGGTTGATGCAGAAAGG + Intronic
1097934390 12:65228768-65228790 CAATGTGTAATGATACAGTCAGG + Intronic
1098538265 12:71620753-71620775 AAGTGTGTTTTGATGGAGTAAGG - Intronic
1101668742 12:106846408-106846430 TAGTGTTTCTAGATACAGTAAGG - Intronic
1103128037 12:118441664-118441686 GTGTGTGTGTTGGTACACTAGGG + Intergenic
1104706953 12:130954788-130954810 CAGTGTGTGGTGAGGCAGTGAGG - Intronic
1104958976 12:132479253-132479275 CAGTGTGTGGTGGTTCATTACGG - Intergenic
1107176270 13:37402931-37402953 TAGTGTTTGATAATACAGTAGGG - Intergenic
1108014303 13:46057972-46057994 AAGTGTGTGTTGTTAGGGTAAGG + Intronic
1110681954 13:78324380-78324402 AAGTCTGTGTTGATACACTGAGG + Intergenic
1113345458 13:109473548-109473570 CAGTGTTTGATAACACAGTAGGG - Intergenic
1113634923 13:111912878-111912900 CAGTGTGTGTTCCTCCAGGAGGG - Intergenic
1114323854 14:21569675-21569697 CTGTGTTTGATCATACAGTATGG + Intergenic
1115257419 14:31417825-31417847 CAGTGTGTAATGATAGAGGAAGG - Intronic
1116267053 14:42705792-42705814 TAGTGTGTTTTGATACTGTGAGG - Intergenic
1117668756 14:58084047-58084069 AAGAGTGTTTTGATACAGTGAGG + Intronic
1118262114 14:64257416-64257438 CTGTGTGTGTAGAGACAGAATGG + Intronic
1118813653 14:69293564-69293586 CATTGTGAGGTGGTACAGTATGG + Intronic
1120801074 14:88689384-88689406 CAGTTTGTGTTGTCACACTAGGG + Intronic
1123173892 14:106399671-106399693 CAATGTGTGTTGATCAAGCAGGG + Intergenic
1123182145 14:106480945-106480967 CAATGTGTGTTGATCAAGCAGGG + Intergenic
1202944760 14_KI270726v1_random:15785-15807 CAATGTGTGTTGATCAAGCAGGG - Intergenic
1124448943 15:29767069-29767091 CAGTTTGTGTTGGTGAAGTACGG - Intronic
1125701744 15:41692471-41692493 CACTGTGTGAAGATACAGTAAGG - Intronic
1137234699 16:46606247-46606269 CAGTGTGTTTTGAAGCAGAAAGG + Intronic
1138413365 16:56856846-56856868 CAGTTCGTGTTGATGCAGCAGGG + Intergenic
1138487423 16:57355573-57355595 CAGTGTGGGTAGAGACAGAATGG - Intergenic
1138854692 16:60675457-60675479 CAGTGTGTTCTGAGCCAGTAAGG - Intergenic
1140492734 16:75353182-75353204 CAGTTTGTTTGGATCCAGTAAGG - Intronic
1142095242 16:88235836-88235858 CAGTGTGAGCTCATACACTATGG + Intergenic
1143718986 17:8797322-8797344 CAGAGTGTGCTGATCCAGCAAGG - Exonic
1146582323 17:34049638-34049660 CAGTGGGTTTTGATAAAGGATGG - Intronic
1149771155 17:59322134-59322156 CACTGTGTTTTGATTAAGTATGG - Intergenic
1153800941 18:8668085-8668107 CAGTATGTGTTGGTCAAGTAAGG - Intergenic
1158511845 18:58097610-58097632 CAGTGTGTGTCTATTCAGAAGGG - Intronic
1160153933 18:76418078-76418100 CAGTGTGTGTTGACAGTGAATGG - Intronic
928831816 2:35495264-35495286 CCATGTGTGTAGGTACAGTAAGG + Intergenic
929835103 2:45388902-45388924 CCGTCTTTGTTGACACAGTAGGG - Exonic
929872662 2:45771953-45771975 CAGTGTGTGTTCAGAGAGTTGGG - Intronic
931222664 2:60302126-60302148 CAGTGTGGGTTTCCACAGTATGG - Intergenic
931596040 2:63944745-63944767 AAGTGTCTGTTCATATAGTAAGG - Intronic
937803305 2:126106051-126106073 CAATGTGGCTTGATACAGTCAGG - Intergenic
937824767 2:126356688-126356710 GAATGTGTGTGGATACAGGAAGG - Intergenic
938836693 2:135110609-135110631 CATTGTGTGTGTGTACAGTAAGG + Intronic
945583488 2:211626967-211626989 AAGTGTGTGTTTATTTAGTAAGG + Intronic
1169961913 20:11169715-11169737 CAGTTAGTATTGATACAGAAAGG - Intergenic
1172355401 20:34276427-34276449 CAGTGTGGGTGGATACTCTAGGG + Intergenic
1172564129 20:35915198-35915220 CAGTGTGTCCTGCTACAGGATGG + Intronic
1174389993 20:50213167-50213189 CAGTGCGTGTTGCTACCTTATGG - Intergenic
1181516334 22:23415630-23415652 CAGTGTGTTTGCATACAGTCCGG - Intergenic
1183618714 22:38960317-38960339 CAGTGTGTGTGGATCCAGCGAGG - Intronic
1183623916 22:38990262-38990284 CAGTGTGTGTGGATCCAGCGAGG - Intronic
1183932631 22:41245096-41245118 CTGTGTGAGTTGATACGGTAGGG - Intergenic
949413573 3:3793330-3793352 CATTGTATGTTGATACGGTGTGG + Intronic
949495628 3:4628982-4629004 CAGTGTGTGTTGTTTCAGACGGG + Intronic
949761425 3:7475208-7475230 TATTGTGTGGTGATACTGTAAGG + Intronic
951508244 3:23473162-23473184 CAATGTGTATTGATAGAGTGGGG - Intronic
952753393 3:36844019-36844041 CATTGTGTTTGGATTCAGTATGG - Intronic
954854188 3:53628358-53628380 CAGTGTGTGTTGACTCTCTAAGG - Intronic
957034671 3:75282703-75282725 CAGTGTTTGTTCATACAAGAGGG + Intergenic
960249389 3:115435549-115435571 CAGTGTGTGTTCATATGGGAAGG + Intergenic
961078540 3:124004288-124004310 CAGTGTTTGTTCATACAAGAGGG + Intergenic
961304934 3:125952159-125952181 CAGTGTTTGTTCATACAAGAGGG - Intergenic
963254183 3:143128397-143128419 CAGTGTGTGCTGCTACAGATTGG + Intergenic
965771347 3:172184645-172184667 CAGTGTGTGATCATCCAGGAGGG + Intronic
967798768 3:193630204-193630226 CTGTGTGTGTTTATGCAGGATGG - Intronic
970260785 4:14222207-14222229 AGGTGTGTGTTGTTACAGCATGG - Intergenic
970631950 4:17956715-17956737 TAGTGTTTGATGGTACAGTAGGG + Intronic
971163466 4:24157947-24157969 CAGTGTGTGTTGGAAGGGTAAGG - Intergenic
971866308 4:32176943-32176965 CTGTGTGAGTTGGTAGAGTATGG + Intergenic
977983335 4:103352501-103352523 TAGTGTTTGATAATACAGTAGGG - Intergenic
979155722 4:117387263-117387285 TATTGTGTGTTTATTCAGTAAGG - Intergenic
980335375 4:131467161-131467183 CAGTTGGTGTTGATACTGAAGGG - Intergenic
981341438 4:143626370-143626392 CAGTGCATGTAGATAGAGTATGG + Intronic
981347360 4:143691753-143691775 CAGTCTGTGATGACACTGTAAGG - Intronic
982734707 4:158993408-158993430 CAATGTGTGTTAATAGAGAAAGG + Intronic
984073422 4:175145961-175145983 AATTGTGTGTTGAGACATTAAGG - Intergenic
985565879 5:616994-617016 CAGTGTGTGTGGTTGCAGGAGGG + Intronic
987029920 5:13966421-13966443 CAGTGTGTGAAGATTCCGTAAGG - Intergenic
994240394 5:97412627-97412649 AAATTTGTGTTGATTCAGTAAGG - Intergenic
1000107126 5:158070426-158070448 CAGTGTGTTTTTAAACAGGATGG - Intergenic
1001457111 5:171872322-171872344 TAGAGTGTGTTGAGACAGTGGGG + Intronic
1003558546 6:7162083-7162105 CAGTGTGTTTTGAGAAAGGAGGG - Intronic
1009725710 6:67533308-67533330 CAGGTTGTGCTGATACAGGAAGG - Intergenic
1014695887 6:124621309-124621331 CAAAGTGTCTTGATACACTACGG - Intronic
1020207526 7:6130541-6130563 CAGGGTTTGTTCATCCAGTATGG + Intronic
1027507864 7:79040530-79040552 CAGTTGGTGTTGATATAGTTTGG + Intronic
1033301133 7:140186853-140186875 CTGTGGTTGTTGATATAGTAGGG - Intergenic
1035348257 7:158222656-158222678 AATTGTGTGTTGTTACAGTTTGG - Intronic
1036477202 8:9104129-9104151 GAGTGGGTGATGATAGAGTAAGG + Intronic
1036537824 8:9668800-9668822 TAGTGTGTGTTGAGAAGGTAAGG + Intronic
1039286095 8:36042395-36042417 AAATATGTGTTGATTCAGTAAGG - Intergenic
1042126442 8:65542072-65542094 CAGTGTCTGCTGATTCACTATGG - Intergenic
1046366783 8:113243283-113243305 CAGTGACTGTTGGTACATTAAGG + Intronic
1047602571 8:126441001-126441023 CAGTGTGTGATACTACATTAAGG + Intergenic
1048367484 8:133750959-133750981 CAGTGTCTGATGATACATTCTGG - Intergenic
1051618100 9:19026032-19026054 CAGTGTTTGATAATACAGTAGGG + Intronic
1052779939 9:32771070-32771092 TAGTGTTTGATGGTACAGTAGGG + Intergenic
1054718227 9:68578628-68578650 CAGTGTGTGATGTTCCAGAAGGG - Intergenic
1054915019 9:70487514-70487536 CAGTGTTTGATAACACAGTAGGG + Intergenic
1055170124 9:73247068-73247090 CAGTGTGTGCTGAATCAATAGGG + Intergenic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058698342 9:107579061-107579083 ATGTCTGTGTTGATAAAGTAGGG + Intergenic
1186765950 X:12770854-12770876 CAGTGTGTTATAATCCAGTAGGG + Intergenic
1193569161 X:83120984-83121006 CAGTGTGTGTTGTTCCAAGAAGG + Intergenic
1194490663 X:94544563-94544585 CTGTGTGCGTTGGTACATTAAGG - Intergenic
1196570414 X:117260378-117260400 CAGTGTGTCTTGAGGCAGCATGG - Intergenic