ID: 1075218017

View in Genome Browser
Species Human (GRCh38)
Location 10:120555626-120555648
Sequence GTGCAGAGACAGAAAGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075218014_1075218017 1 Left 1075218014 10:120555602-120555624 CCTTACTGTATCAACACACACTG 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG No data
1075218013_1075218017 13 Left 1075218013 10:120555590-120555612 CCTTGGCAAACACCTTACTGTAT 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075218017 Original CRISPR GTGCAGAGACAGAAAGAGCA CGG Intronic
No off target data available for this crispr