ID: 1075220817

View in Genome Browser
Species Human (GRCh38)
Location 10:120582855-120582877
Sequence GAGCCCAGTGGAGAACACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075220817_1075220819 -6 Left 1075220817 10:120582855-120582877 CCGGCGTGTTCTCCACTGGGCTC 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1075220819 10:120582872-120582894 GGGCTCAGTACTGAGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075220817 Original CRISPR GAGCCCAGTGGAGAACACGC CGG (reversed) Intronic
900100305 1:959638-959660 GAGTCCAGTGGAAAACGCGAGGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900386857 1:2414576-2414598 GAGCCCGGTGGAGAGCAGACGGG - Intergenic
901493105 1:9606596-9606618 GAGCCCAGTGGACAACGTGCTGG - Intronic
903743439 1:25571652-25571674 CAGCACAGTGGGGAACACACTGG - Intergenic
904696124 1:32332536-32332558 GAGCCCTGTTGAGAACAGGTTGG - Intronic
906520236 1:46462426-46462448 GAGCGCAGAGGAGAGCAGGCTGG - Intergenic
906690911 1:47792223-47792245 CAGCCCAGAGGAGAACAGGATGG + Intronic
907185092 1:52602977-52602999 GAGTCCAGTGAAGAACACTGTGG + Intronic
908131430 1:61079679-61079701 GAGAGCAGTGGAGGAAACGCAGG - Intronic
909069190 1:70973930-70973952 GAGCCATATGGCGAACACGCTGG + Intronic
910148979 1:84118254-84118276 GAGTACAATGGAGAACACACAGG - Intronic
911854885 1:102863757-102863779 GAGCCCAAGGGAGAAAAGGCAGG - Intergenic
918444656 1:184605248-184605270 CAGCCCTGCAGAGAACACGCAGG + Intronic
918689869 1:187466688-187466710 GAACCTAGTGGAGAACTCACAGG - Intergenic
919778198 1:201207471-201207493 GGGCCCAGTGGAGGACAAGAGGG + Exonic
1062992219 10:1831033-1831055 CAGCCCAGTGGACAACACCATGG + Intergenic
1064101958 10:12471634-12471656 GAGCTCAGTGGAGAACCAGGAGG - Intronic
1064640707 10:17412520-17412542 CAGCCAAGTGGAGCTCACGCAGG - Intronic
1070519205 10:77237415-77237437 GAGCCTAGTGGTGAACACCAGGG - Intronic
1070546769 10:77458640-77458662 GATCCCAGGGGAGAACCAGCTGG + Intronic
1072617666 10:97060208-97060230 GAGCCCAGCAGATAACACCCAGG - Intronic
1075220817 10:120582855-120582877 GAGCCCAGTGGAGAACACGCCGG - Intronic
1075563983 10:123490313-123490335 GGGGCCAGTGGAGATGACGCTGG - Intergenic
1076192960 10:128495723-128495745 GAACCCAGTCCAGACCACGCTGG - Intergenic
1076651640 10:131993445-131993467 GAGCACTTTGGAGAACACGATGG - Intergenic
1077374534 11:2199345-2199367 GAGCCCAGTGGAGACGGAGCTGG - Intergenic
1077387593 11:2278088-2278110 GAGCCCAGTGGAGTACTTGGAGG + Intergenic
1081441787 11:43089024-43089046 GATCCCACTGGAGAACAGCCAGG + Intergenic
1083967382 11:66051107-66051129 GCCCCCAGTGGAGAAGAAGCTGG - Intronic
1084446442 11:69206206-69206228 GCGCCCAGTGGCCAACACGGAGG + Intergenic
1085271578 11:75273110-75273132 GAGCCCAGTGGAGATGAGGAAGG + Intronic
1092456144 12:8644706-8644728 GAGCACAGTGGAGGAGAGGCAGG - Intronic
1093866509 12:24233813-24233835 GATCCCAGGAGAGAACAAGCTGG + Intergenic
1095054403 12:37582390-37582412 GAGTCCAGGGGAGCACACACTGG - Intergenic
1096711817 12:53463042-53463064 GAGCCTAGGGGACAACACACTGG - Intronic
1098486312 12:71025887-71025909 TAGCCCAGGGGAGCACACACTGG + Intergenic
1103936907 12:124481773-124481795 GAGCACAGGGGGGAACACACAGG + Intronic
1104192636 12:126497617-126497639 GAGCCCAGTGCAGACTACACTGG + Intergenic
1109520619 13:63505525-63505547 GAGCACAGTGGACACCCCGCCGG + Intergenic
1119426050 14:74535372-74535394 GAGGCCAGTGGGGAACAAGGTGG - Intronic
1119714927 14:76852479-76852501 GAGCCCAGTTGAGGACAGCCAGG + Intronic
1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG + Intergenic
1122986179 14:105212687-105212709 GGGCCCAGGGGAGAGGACGCAGG + Intronic
1124089176 15:26581637-26581659 GAGCCCTGGGCAGAGCACGCTGG - Intronic
1124453768 15:29822222-29822244 GCGCCCCGTGGAGAAGACCCGGG - Exonic
1124633060 15:31348109-31348131 GAGGAAAGTGGAAAACACGCAGG + Intronic
1126345181 15:47685967-47685989 GAGCCCACTGGAGAGCAGGTGGG + Intronic
1127656796 15:61063048-61063070 GAGCACACTGGTGAATACGCCGG - Intronic
1129149322 15:73677783-73677805 GGGCCAAGTGGAGAACACTGTGG + Intergenic
1131775439 15:95791851-95791873 GAGCTCAGTGGAGAATATGTTGG - Intergenic
1137732645 16:50699852-50699874 CAGCCATGTGGAGAACATGCTGG + Exonic
1139318271 16:66092017-66092039 GGGCTCAGTGCAGAACATGCTGG + Intergenic
1139923509 16:70473623-70473645 GCACCCAGTACAGAACACGCAGG - Intronic
1140244365 16:73234743-73234765 GAGCCCAGTGGAGAAACATCTGG - Intergenic
1141049037 16:80744212-80744234 GAGCCCTGGGGAACACACGCTGG + Intronic
1141836930 16:86546942-86546964 GAGCACAGTGGTGAAAACACAGG + Intronic
1141847157 16:86618638-86618660 GAGCCCAGTAGAGATCAGCCAGG + Intergenic
1142411531 16:89919411-89919433 GAGCTTGGTGGAGAACGCGCTGG + Exonic
1145374943 17:22338453-22338475 GAGTCCAGGGGAGCACACACTGG - Intergenic
1149106634 17:52975267-52975289 GGGCTCAGTGTAGAACAAGCAGG - Intergenic
1151875559 17:76866281-76866303 CAGCACAGTGGAGAGCAAGCAGG + Intergenic
1161014557 19:1977304-1977326 GAGCCTAGAGGTGAACAGGCCGG - Intronic
1161979891 19:7624874-7624896 GAGCCAGGTGGAGGACAGGCGGG - Intronic
1164416382 19:28049488-28049510 GAGGACAGTGGTGAACACTCAGG + Intergenic
1167445540 19:49535032-49535054 GAGCCCTGTGGAGGACAGACTGG - Intronic
1168195040 19:54767946-54767968 GAACCCAGTGGAGAACAGATGGG - Intronic
925158522 2:1664852-1664874 CAGCCCTGTCCAGAACACGCTGG + Intronic
926783983 2:16502132-16502154 GAGCCTAGAGGAAAACACTCGGG - Intergenic
931377335 2:61719070-61719092 CATCCCAGTGGAGAATACACTGG - Intergenic
932409385 2:71536224-71536246 GAGACCAGAGGAGAACACGCTGG - Intronic
936012444 2:108933697-108933719 CACCCCAGTGGTGAACTCGCTGG + Intronic
942746563 2:179240865-179240887 GAGCCCAGTGGAGCCCACAAGGG + Intronic
943193750 2:184716957-184716979 GACCACAGTGTAGAACACCCTGG + Intronic
944202748 2:197125390-197125412 CTGCCCAGTGCAGAGCACGCCGG + Exonic
944936552 2:204575637-204575659 GAGCCAGGAGGAGAACAGGCAGG - Intronic
945336242 2:208595824-208595846 AAGCCCAGTGCAGAACTCTCAGG + Intronic
946049697 2:216852252-216852274 GAGCCCAGTGGATCCCAGGCTGG + Intergenic
948715157 2:239856465-239856487 GAGCCCAGCGGAGAACTCCATGG + Intergenic
1171228726 20:23464827-23464849 GAGACCAGAGGAGACCAAGCAGG + Intergenic
1171527853 20:25829958-25829980 GAGTCCAGGGGAGCACACACTGG + Intronic
1171548973 20:26025922-26025944 GAGTCCAGGGGAGCACACACTGG - Intergenic
1172307203 20:33889156-33889178 GGGCCCAGAGGAAAACAGGCAGG - Intergenic
1175972503 20:62693749-62693771 GAGCACAGTGGAGATCAGCCAGG - Intergenic
1176284340 21:5011586-5011608 GAGCCCAGAGGAGAAAGCTCCGG - Intergenic
1179606453 21:42518735-42518757 GAAACCACTGGAGACCACGCGGG - Intronic
1179872841 21:44251889-44251911 GAGCCCAGAGGAGAAAGCTCCGG + Intronic
1180074646 21:45456363-45456385 GAGCCCAGAGGAGAAGGCGGAGG - Intronic
1181540996 22:23573286-23573308 GAGCACCGTGGAGAAGACGGTGG - Exonic
1182275940 22:29188664-29188686 GAGGCCAGTGGGGAACATTCTGG + Intergenic
1182895793 22:33858227-33858249 GAGCCCAGTGGACATCCTGCTGG + Intronic
1185374509 22:50475763-50475785 GAGCCCAGAGCAGAACATGCTGG + Intergenic
1185377707 22:50489705-50489727 GAGCCCCGTGAAGAACCCCCAGG - Intronic
949311123 3:2699322-2699344 GAACCGAGTGGAGAACAGCCAGG - Intronic
950465826 3:13153165-13153187 GAGCCCTGAGGAGGACACGGGGG - Intergenic
950558322 3:13708134-13708156 GAGCCCTGTGGAGAAAACTGAGG + Intergenic
951299435 3:20975684-20975706 GAGCCCAGTGGAGAATTCACAGG - Intergenic
957506232 3:81125069-81125091 GAGTCCAATGGAGAACTCACGGG + Intergenic
960984622 3:123267993-123268015 GATATCAGTGGAGAACACGTGGG - Intronic
968867102 4:3220088-3220110 GAGCCCAGTGGAGAGAAGTCGGG + Intronic
969207386 4:5657027-5657049 GAGCCCAGTGGTTAAAACCCAGG - Intronic
970260720 4:14221479-14221501 CAGCACAGTGAAGAACAGGCAGG - Intergenic
973306261 4:48654477-48654499 TACCCCACTGGAGATCACGCTGG + Intronic
973307047 4:48664123-48664145 GAGCCCAGTGGATAGGACTCTGG - Intronic
980166988 4:129240945-129240967 GATCCCAGAGGAGAACTGGCTGG + Intergenic
980550409 4:134327878-134327900 GAGCCCAGTGGAGAAACTGGAGG + Intergenic
982510809 4:156280938-156280960 GAACACAGTGAAGAACAAGCTGG + Intergenic
983239053 4:165210306-165210328 CAGGCCAGTGGAGAACAAGGTGG - Intronic
983524222 4:168744104-168744126 CAGCCCAGAGGACAACACTCTGG + Intronic
984663592 4:182401059-182401081 GAGTCCAGTGGAGCAGAAGCAGG - Intronic
985629126 5:1005640-1005662 GGGCCCAGGAGAGGACACGCCGG + Intergenic
988252557 5:28778797-28778819 GAGCCATGTGAAGAACACGTGGG + Intergenic
989203982 5:38793419-38793441 GAGCCCAGTGGTGATCACACAGG + Intergenic
991657869 5:68921293-68921315 GAGCCCAGTGGATCCCACACCGG - Intergenic
993472161 5:88319159-88319181 GAGCCCAGTTGAGACCAGCCTGG - Intergenic
996633771 5:125666630-125666652 CAGCCCAGTGGAGAATATGTGGG + Intergenic
997286905 5:132686507-132686529 AAGCCCAGTTGAGGAAACGCTGG - Intergenic
998805249 5:145912236-145912258 GAGTCCAGTGGAGAATACAGTGG + Intergenic
1001495864 5:172187612-172187634 GAGCGCAGTGCAGGACACACAGG + Intronic
1002318301 5:178359899-178359921 GAGCCCAGTGGAGAACGAGGAGG + Intronic
1004727442 6:18325079-18325101 GAGTCCAGTGGAGTCCACTCAGG + Intergenic
1006003659 6:30986369-30986391 GACCCCATTGGAGGTCACGCTGG - Exonic
1006461447 6:34161617-34161639 GAGCCCAGAGGAGAAGCAGCAGG + Intergenic
1008997006 6:57671149-57671171 GAGCTCAGTGGAGAAGATGCGGG + Intergenic
1009185522 6:60570478-60570500 GGGCTCAGTGGAGAAGATGCGGG + Intergenic
1012232672 6:96778508-96778530 GAGCCCAGAGGAAAATACACAGG + Intergenic
1020423224 7:8034683-8034705 GAGTCCAGTGGAGAACTCACAGG + Intronic
1022650046 7:32266339-32266361 GAACCCAGTTGAGAACAAGTGGG + Intronic
1023824323 7:43998605-43998627 GAGCCCAGCCGGGAACCCGCAGG + Intergenic
1024282874 7:47733912-47733934 GAGTCCAGTGCAGAGAACGCTGG + Intronic
1025012930 7:55413489-55413511 GAGCCCTGTGGAGAGCAAGCAGG + Intronic
1025297790 7:57789924-57789946 GAGTCCAGGGGAGCACACACTGG - Intergenic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1029258510 7:99285652-99285674 GAGTCCAGAGGAGAAGAGGCTGG + Intergenic
1031057151 7:117004296-117004318 GAGCCAAGTGGATAACACGAAGG - Intronic
1034424973 7:151009515-151009537 GAGCCGCGTGGAGGACCCGCCGG + Exonic
1034765008 7:153711967-153711989 TAGCCCAGTTGGGAACATGCTGG - Intergenic
1035437085 7:158867358-158867380 AACCTCAGTGCAGAACACGCAGG - Intronic
1036706838 8:11052759-11052781 GAGCCCAGAGCAGCACACTCCGG + Intronic
1038431971 8:27507586-27507608 GAGCACAGGGGAGAAGAGGCAGG + Intronic
1046973145 8:120245002-120245024 GAGTCCAGTGGAGAGCAGACAGG - Intronic
1048254870 8:132898138-132898160 GAGCCAAGGGGAGAACATTCAGG - Intronic
1050004861 9:1119425-1119447 GAGCCCAGGGAAGAGCAGGCAGG + Intergenic
1051371794 9:16365182-16365204 GTGGCCAGTGGAGGACAGGCAGG - Intergenic
1053795821 9:41726105-41726127 GAGTCCAGGGGAGCACACACTGG + Intergenic
1054149363 9:61588768-61588790 GAGTCCAGGGGAGCACACACTGG - Intergenic
1054184229 9:61938176-61938198 GAGTCCAGGGGAGCACACACTGG + Intergenic
1054469123 9:65519879-65519901 GAGTCCAGGGGAGCACACACTGG - Intergenic
1054654277 9:67650319-67650341 GAGTCCAGGGGAGCACACACTGG - Intergenic
1055359288 9:75472155-75472177 GATCCCAGTGGAGTGCTCGCTGG + Intergenic
1059565130 9:115376775-115376797 GAGCCCAGTGCAAAACAAGCAGG + Intronic
1060802258 9:126552127-126552149 GTGCCCAGTGGAGAAGAGACAGG - Intergenic
1061195774 9:129106425-129106447 GAGACCAGAGGAGACCCCGCAGG + Intronic
1061402462 9:130375930-130375952 GAGCTCATTGGTGACCACGCAGG - Intronic
1189613630 X:42763428-42763450 CAGCCCAGTGGAGAGGACGTAGG - Intergenic
1192940362 X:75904872-75904894 AAGCACAGTGGACAACATGCTGG + Intergenic
1195311043 X:103631876-103631898 GAGTCCAGTGGAGAAAAGGAAGG - Intergenic