ID: 1075221856

View in Genome Browser
Species Human (GRCh38)
Location 10:120592054-120592076
Sequence AGGAATAAACGTTCTCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075221856_1075221861 4 Left 1075221856 10:120592054-120592076 CCATAATGAGAACGTTTATTCCT No data
Right 1075221861 10:120592081-120592103 CCCTGATTTTTTTTTGGATGTGG No data
1075221856_1075221865 27 Left 1075221856 10:120592054-120592076 CCATAATGAGAACGTTTATTCCT No data
Right 1075221865 10:120592104-120592126 GGTTCCTAATTCAGTCTCTTTGG No data
1075221856_1075221858 -2 Left 1075221856 10:120592054-120592076 CCATAATGAGAACGTTTATTCCT No data
Right 1075221858 10:120592075-120592097 CTCAACCCCTGATTTTTTTTTGG No data
1075221856_1075221864 6 Left 1075221856 10:120592054-120592076 CCATAATGAGAACGTTTATTCCT No data
Right 1075221864 10:120592083-120592105 CTGATTTTTTTTTGGATGTGGGG No data
1075221856_1075221863 5 Left 1075221856 10:120592054-120592076 CCATAATGAGAACGTTTATTCCT No data
Right 1075221863 10:120592082-120592104 CCTGATTTTTTTTTGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075221856 Original CRISPR AGGAATAAACGTTCTCATTA TGG (reversed) Intergenic
No off target data available for this crispr