ID: 1075226101

View in Genome Browser
Species Human (GRCh38)
Location 10:120630660-120630682
Sequence CCTTGCAAAGATGACTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075226097_1075226101 11 Left 1075226097 10:120630626-120630648 CCCAAATTATATTCTTTGACATA No data
Right 1075226101 10:120630660-120630682 CCTTGCAAAGATGACTCTTGTGG No data
1075226096_1075226101 12 Left 1075226096 10:120630625-120630647 CCCCAAATTATATTCTTTGACAT No data
Right 1075226101 10:120630660-120630682 CCTTGCAAAGATGACTCTTGTGG No data
1075226098_1075226101 10 Left 1075226098 10:120630627-120630649 CCAAATTATATTCTTTGACATAT No data
Right 1075226101 10:120630660-120630682 CCTTGCAAAGATGACTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075226101 Original CRISPR CCTTGCAAAGATGACTCTTG TGG Intergenic
No off target data available for this crispr