ID: 1075226584

View in Genome Browser
Species Human (GRCh38)
Location 10:120634828-120634850
Sequence GAGGATGCAGGGAAGGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075226584_1075226594 28 Left 1075226584 10:120634828-120634850 CCTCGGTCCTTCCCTGCATCCTC No data
Right 1075226594 10:120634879-120634901 TCAGCTCTGCTAGACTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075226584 Original CRISPR GAGGATGCAGGGAAGGACCG AGG (reversed) Intergenic
No off target data available for this crispr