ID: 1075230262

View in Genome Browser
Species Human (GRCh38)
Location 10:120670452-120670474
Sequence CATTTGTTTTAGAAGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075230262_1075230264 23 Left 1075230262 10:120670452-120670474 CCATTTGTCTTCTAAAACAAATG No data
Right 1075230264 10:120670498-120670520 GCACTTAAAGTTTTACTCTCGGG No data
1075230262_1075230265 28 Left 1075230262 10:120670452-120670474 CCATTTGTCTTCTAAAACAAATG No data
Right 1075230265 10:120670503-120670525 TAAAGTTTTACTCTCGGGCTTGG No data
1075230262_1075230263 22 Left 1075230262 10:120670452-120670474 CCATTTGTCTTCTAAAACAAATG No data
Right 1075230263 10:120670497-120670519 AGCACTTAAAGTTTTACTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075230262 Original CRISPR CATTTGTTTTAGAAGACAAA TGG (reversed) Intergenic
No off target data available for this crispr