ID: 1075232933

View in Genome Browser
Species Human (GRCh38)
Location 10:120699539-120699561
Sequence GAGCCAGTGGGTGGTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075232933_1075232941 15 Left 1075232933 10:120699539-120699561 CCAGTGAGACCACCCACTGGCTC No data
Right 1075232941 10:120699577-120699599 CTGCTGGCTGGGTACCGTGATGG No data
1075232933_1075232942 27 Left 1075232933 10:120699539-120699561 CCAGTGAGACCACCCACTGGCTC No data
Right 1075232942 10:120699589-120699611 TACCGTGATGGCCTCTAGCCAGG No data
1075232933_1075232938 -1 Left 1075232933 10:120699539-120699561 CCAGTGAGACCACCCACTGGCTC No data
Right 1075232938 10:120699561-120699583 CTACTATCAGGCAGAGCTGCTGG No data
1075232933_1075232939 3 Left 1075232933 10:120699539-120699561 CCAGTGAGACCACCCACTGGCTC No data
Right 1075232939 10:120699565-120699587 TATCAGGCAGAGCTGCTGGCTGG No data
1075232933_1075232940 4 Left 1075232933 10:120699539-120699561 CCAGTGAGACCACCCACTGGCTC No data
Right 1075232940 10:120699566-120699588 ATCAGGCAGAGCTGCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075232933 Original CRISPR GAGCCAGTGGGTGGTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr