ID: 1075241579

View in Genome Browser
Species Human (GRCh38)
Location 10:120784165-120784187
Sequence CTGTATCAACAGAAGTATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075241572_1075241579 17 Left 1075241572 10:120784125-120784147 CCTATGCAGACAACAACAGCCAT No data
Right 1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG No data
1075241569_1075241579 29 Left 1075241569 10:120784113-120784135 CCAGGTTTCCTCCCTATGCAGAC No data
Right 1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG No data
1075241570_1075241579 21 Left 1075241570 10:120784121-120784143 CCTCCCTATGCAGACAACAACAG No data
Right 1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG No data
1075241571_1075241579 18 Left 1075241571 10:120784124-120784146 CCCTATGCAGACAACAACAGCCA No data
Right 1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG No data
1075241575_1075241579 -2 Left 1075241575 10:120784144-120784166 CCATGGGAACTTCCCTCTCCTCT No data
Right 1075241579 10:120784165-120784187 CTGTATCAACAGAAGTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075241579 Original CRISPR CTGTATCAACAGAAGTATAG TGG Intergenic
No off target data available for this crispr