ID: 1075252186

View in Genome Browser
Species Human (GRCh38)
Location 10:120889633-120889655
Sequence TCCTCCCAAGTTTAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075252186_1075252194 23 Left 1075252186 10:120889633-120889655 CCCTTCACCTAAACTTGGGAGGA 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1075252194 10:120889679-120889701 AGGAGATAGTTATCTGCAAGTGG 0: 1
1: 0
2: 1
3: 5
4: 148
1075252186_1075252191 3 Left 1075252186 10:120889633-120889655 CCCTTCACCTAAACTTGGGAGGA 0: 1
1: 0
2: 0
3: 14
4: 137
Right 1075252191 10:120889659-120889681 GCCTTGAGCCAAGCATTCTTAGG 0: 1
1: 0
2: 2
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075252186 Original CRISPR TCCTCCCAAGTTTAGGTGAA GGG (reversed) Intronic
900941320 1:5800393-5800415 GCATCCCCAGGTTAGGTGAAAGG + Intergenic
903342687 1:22664301-22664323 TTCTCCCAAGTTTGTTTGAAGGG - Intergenic
903506569 1:23839890-23839912 TCCTCCCAGGTTCAAGTGATTGG + Intergenic
905974389 1:42164455-42164477 TCCTCCAAAGTTGAAGGGAAAGG + Intronic
909139543 1:71846172-71846194 TCCTCTGAAGTTGAGCTGAATGG + Intronic
909966770 1:81922340-81922362 TCCTCCTTAGCTTAAGTGAAAGG - Intronic
911289504 1:96039723-96039745 TCCTCACAAATCAAGGTGAAAGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915433550 1:155885914-155885936 TCCTCCCATGTTCAGGTCTAGGG - Intergenic
916617590 1:166458680-166458702 TCCTCCCAAGTTCAAGGGGAAGG - Intergenic
917120123 1:171638350-171638372 GCCTCCCAAGTGTGGGTGATAGG + Intronic
918167611 1:181965365-181965387 TCCTCTGAAATTTAGGTGGAGGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922107393 1:222524381-222524403 TCCTCCCAAGTCCAGGTGGGAGG + Intronic
923192829 1:231636734-231636756 TCATACCAAGATTAGCTGAAGGG - Intronic
923228262 1:231959768-231959790 TCTTCCCAAGTCTAGGAGCATGG - Intronic
1068464582 10:57373104-57373126 TCCTCACAAATTGATGTGAATGG - Intergenic
1069779656 10:70946691-70946713 TTCTGCCAAGTCTAGGTGGATGG + Intergenic
1069842903 10:71351075-71351097 TCCTGCTAAGTTTTGGGGAAAGG + Intronic
1071383655 10:85098060-85098082 TCCTCTCAAATTCAAGTGAAAGG + Intergenic
1072146264 10:92641683-92641705 ATTTCCCAAGTTTTGGTGAAAGG - Intronic
1074427161 10:113361539-113361561 TCCTCCGTGGTTTGGGTGAAGGG + Intergenic
1075252186 10:120889633-120889655 TCCTCCCAAGTTTAGGTGAAGGG - Intronic
1076348250 10:129795393-129795415 TATTTCCAAGTTCAGGTGAAGGG + Intergenic
1077133538 11:987086-987108 ACCTCCCAAGAGTAGGTGACAGG - Intronic
1078075999 11:8161399-8161421 TATTCTCAGGTTTAGGTGAAGGG - Intronic
1078324986 11:10372603-10372625 TCCTCACAAGTTGATGTGGATGG + Intronic
1082948388 11:58785541-58785563 TCCTCACAAATTTATGTGGATGG + Intergenic
1087850730 11:103026755-103026777 TCCTCCAAAGTTCAGCTCAAAGG - Intergenic
1090955997 11:131513277-131513299 TCCTCCAAACTGTGGGTGAAGGG - Intronic
1092710693 12:11334318-11334340 TCCCCGTAAGTTTATGTGAATGG + Intergenic
1092989759 12:13885158-13885180 TTCTCCCAAATTTTGGTGTAGGG - Intronic
1098551152 12:71762616-71762638 TCCTCTCCAGCTTAGGCGAAAGG - Intronic
1099249043 12:80229804-80229826 TCTTTCCAAGTTTGTGTGAATGG + Intronic
1101807526 12:108077478-108077500 TACTCCCAAGTCTAGCTGAGTGG + Intergenic
1101987927 12:109461926-109461948 TCCTCCCCACTTTGGGAGAAGGG + Intronic
1102305322 12:111800255-111800277 GCCTGCCAAGTTCAGGTGCAGGG - Intronic
1113272022 13:108684683-108684705 TCCTCCAAAGTTTAGGGGTTGGG - Intronic
1113292253 13:108920053-108920075 TCTTCAGAAGTTTAGGAGAAGGG + Intronic
1115688098 14:35817903-35817925 TCCTCCCAAATTGATGTGGATGG - Intergenic
1115980593 14:39047608-39047630 TCCTTCCAAGTTAAGCTAAAAGG + Intronic
1116327163 14:43544744-43544766 TCCTCCAAAGTTGATGTGGATGG - Intergenic
1116691360 14:48110529-48110551 TCCTCCCAATTTTATGCTAAAGG - Intergenic
1117031136 14:51671795-51671817 TCCTCACAAATTGATGTGAATGG - Intronic
1117714313 14:58564828-58564850 TCCTCCCTAAACTAGGTGAATGG - Intergenic
1118805629 14:69234356-69234378 TTCTCTCAAGTTTGGGGGAAGGG - Intronic
1119444287 14:74650496-74650518 ACCTCCCAAGCTCAGGTGACAGG + Intergenic
1121375460 14:93406026-93406048 TCCTTGGTAGTTTAGGTGAATGG - Intronic
1126994019 15:54418864-54418886 TGCTTCCAAGTTTAGGTCAATGG - Intronic
1127618451 15:60710155-60710177 TCTTCCCAAGTCTAAGTGCAAGG - Intronic
1128586075 15:68851229-68851251 TCCTCCCAACTTTAGGCCTAGGG + Intronic
1130160963 15:81399598-81399620 GCCTTTCAAGTTTTGGTGAAAGG - Intergenic
1135351160 16:21730243-21730265 TCCTGCCAAGTTCAAGAGAAAGG + Intronic
1135449640 16:22546370-22546392 TCCTGCCAAGTTCAAGAGAAAGG + Intergenic
1137378244 16:47973491-47973513 TTCTCTAAAGTTTAGGTGGATGG + Intergenic
1144247865 17:13385327-13385349 AACTCCCAAGTTTATGTGAAAGG - Intergenic
1145366869 17:22272391-22272413 TATCCCCAAGTTTAGGTGGATGG + Intergenic
1148542525 17:48492203-48492225 TCCTCCCAAGGAGAGGGGAAAGG - Intergenic
1203176821 17_KI270729v1_random:25038-25060 TCATCCCTAGTTTAAGGGAATGG + Intergenic
1153287486 18:3469919-3469941 TCATCCTAAGCCTAGGTGAAAGG + Intergenic
1156819092 18:41349895-41349917 GCCTCCCAAGTTTTGGTGATGGG + Intergenic
1159034820 18:63266817-63266839 TTCTCCAAACTTTAGGAGAAAGG - Intronic
1162228170 19:9242093-9242115 CACAACCAAGTTTAGGTGAAGGG - Intergenic
1162498722 19:11038641-11038663 TCCTTCCAAGGGTAGGGGAAAGG + Intronic
1163757059 19:19112442-19112464 TCCTGCCAAGTTTAAGTGCTGGG - Exonic
1164932359 19:32185520-32185542 TCTTCCCAGGTGTAGGGGAAAGG - Intergenic
1165934713 19:39382355-39382377 TCCTCCCAACTGTATGTGTAAGG + Intronic
1167874707 19:52402200-52402222 TCTTCCCAAGTTCATGTCAATGG - Intronic
1167902811 19:52634869-52634891 TCTTCCCAAGTTCATGTGATTGG + Intronic
1168540672 19:57207138-57207160 ACCTCCCAAGTTTCTGTGAATGG + Intronic
1168545958 19:57250047-57250069 ACCTCCCAAGTTTCCGTGAATGG + Intronic
928273489 2:29878020-29878042 TTCTCCCAAGTTGGGGTGGATGG - Intronic
931867575 2:66428905-66428927 TCTTCCCAAGTTTAGGCATATGG + Intergenic
933407577 2:81880894-81880916 TCCTCCCAAGTTTTAGGGATAGG - Intergenic
937861164 2:126711471-126711493 TTCTCACAAGTTGATGTGAATGG - Intergenic
939109585 2:137991495-137991517 TCCTGCCTTGTATAGGTGAAAGG + Intronic
941261317 2:163301441-163301463 TCCTTCCAAGTTAAGGTTATGGG - Intergenic
944266001 2:197727367-197727389 ACCTCCTAATTTTAGGTGGAGGG - Exonic
946151586 2:217776668-217776690 TCCTCACAAATTGATGTGAATGG + Intergenic
946282771 2:218678371-218678393 TCCTCCCCTGTTTAGTTGAGGGG + Intronic
947355518 2:229290894-229290916 TCCTCACAAATTGATGTGAAGGG - Intergenic
948321407 2:237072587-237072609 CCCTCCCAAGTAGAGGTGAGAGG - Intergenic
1170944102 20:20874619-20874641 GCCTCCCAGGTAAAGGTGAAGGG + Intergenic
1171183427 20:23107891-23107913 TACTCCCAAGTCTATGAGAAAGG + Intergenic
1174967842 20:55239388-55239410 TCCTCACAAATTGATGTGAATGG - Intergenic
1175428768 20:58888884-58888906 GCCTCCCAATTTTCGGTGAGTGG - Intronic
1177130437 21:17248472-17248494 ACCTCCGAAATTTAGGTGGAGGG - Intergenic
1178710406 21:34911725-34911747 TGCTCCCAGGTCTAGGTGATGGG - Intronic
1178950559 21:36981830-36981852 TCCTTCTCAGTTTAGGGGAATGG + Intronic
1180721852 22:17915307-17915329 TCTGCCCAAGTGTAGGTGACCGG - Intronic
1183310115 22:37105088-37105110 TCCTCCCAGGTGGATGTGAAGGG + Intronic
1183331602 22:37225118-37225140 TCCTCCCAAGTTCAAGTTCAGGG - Intergenic
1184252669 22:43269629-43269651 TCCTCCCAAGTTGAGGGGGAAGG - Intronic
950348640 3:12324339-12324361 TCCCACCAAGTTTAGAAGAAAGG + Intronic
951067069 3:18278833-18278855 ACCTCCCCAGTATATGTGAATGG + Intronic
951446592 3:22788579-22788601 TCCTCCTAAGATCAGGAGAAAGG + Intergenic
954684171 3:52361566-52361588 TCCTCCCAAGTGGAGTTGGAGGG + Intronic
957125944 3:76160495-76160517 TCCTCACAAGTTGATGTGGATGG + Intronic
961928943 3:130513242-130513264 TCCTCACAAATTGATGTGAATGG - Intergenic
965484209 3:169258691-169258713 TCATCCCAAATTTCTGTGAATGG + Intronic
970360106 4:15300722-15300744 TCCTGCCTAGTTCAGGTCAAAGG + Intergenic
970466712 4:16331031-16331053 TCCTTGCAAGTTGATGTGAATGG - Intergenic
972210364 4:36829528-36829550 TCCACCCAAGTTGCTGTGAAAGG - Intergenic
976715639 4:88120168-88120190 TCCTCTGAAATCTAGGTGAAGGG - Intronic
977827178 4:101547018-101547040 TCCTCCTAAGATCAGGGGAAAGG - Intronic
977930180 4:102742163-102742185 TCCTCCTAAGTTTAAGTCAGTGG - Intronic
978883301 4:113734873-113734895 TACTCCTAAGTTTAGGAAAATGG + Intronic
980716337 4:136635128-136635150 TTCTCCCAAGTTTAGGCCACTGG + Intergenic
981854811 4:149275838-149275860 TCCTCACAAATTGACGTGAAAGG + Intergenic
985201765 4:187491311-187491333 TCCTCCCAAGTCCCGGGGAATGG - Intergenic
987068651 5:14314932-14314954 TCCTCCCAAGTTTTGCTGTTAGG + Intronic
996927168 5:128841330-128841352 GCCTCCCAACTCTATGTGAAAGG - Intronic
997496462 5:134331228-134331250 TCCTCACAAGTTGATGTGAATGG + Intronic
997509017 5:134440676-134440698 TCCTCCCATGTTATGGTGATGGG + Intergenic
998134204 5:139666231-139666253 TCCTCCCAAGTATGGGTGATAGG + Intronic
1001801559 5:174548768-174548790 TCTTGCCATGTTTAGGTGGATGG - Intergenic
1003602157 6:7527267-7527289 TCCCCCCAAGGGTAGGAGAAAGG - Intergenic
1006672098 6:35735890-35735912 TACTTCCAAATTTAGCTGAAAGG + Intergenic
1007348268 6:41249473-41249495 TTCACCCAAGTCTGGGTGAAAGG + Intergenic
1007853325 6:44827020-44827042 TACTTCCAAATTTAGGTGAAGGG + Intronic
1007853421 6:44828603-44828625 TACTTCCAAATTTGGGTGAAGGG + Intronic
1010289443 6:74118253-74118275 TCCTCCAAAGTCTTGATGAATGG - Intergenic
1012216126 6:96586665-96586687 TCCTTGCAAATTTATGTGAATGG - Intronic
1012718462 6:102707849-102707871 TCCTTCCAAGTGTAGGCAAAAGG - Intergenic
1013379060 6:109548548-109548570 TCCTCACAAATTTAAGTGGATGG - Intronic
1022203869 7:28144159-28144181 TCCTCCCAATTTTAAGATAAGGG + Intronic
1024992849 7:55249966-55249988 TCCTCACATGTTGTGGTGAAGGG + Intronic
1025641235 7:63371852-63371874 TGCTCACAAGTCTAGGTGAGTGG + Intergenic
1027052901 7:75030947-75030969 ACCTCCAAAGTTTGGGTGAGGGG - Intronic
1027673495 7:81130933-81130955 TCCACCCAACTATAGGTCAAAGG + Intergenic
1027877306 7:83787360-83787382 TCCTCCTAAGATTATGGGAATGG - Intergenic
1030299235 7:107958892-107958914 TCCTGCCTAATTTAGGCGAAAGG - Intronic
1033988193 7:147251920-147251942 TCCTTCCAAGTTTAATTCAATGG + Intronic
1034568093 7:151931830-151931852 TTCTCCCTTGTTTAGGGGAAAGG + Intergenic
1035930458 8:3774718-3774740 TGCTCTCAAATTTTGGTGAAAGG + Intronic
1038801298 8:30751497-30751519 TCTCCCCAAGTTTATCTGAAGGG + Exonic
1040630955 8:49209816-49209838 TCATCCCTAGTTGGGGTGAAAGG + Intergenic
1040699004 8:50038593-50038615 TCCTCCCCATTTGATGTGAAGGG + Intronic
1041468986 8:58187720-58187742 TCCTCCCATTTTTAGCTGGAAGG - Intronic
1045119015 8:99015125-99015147 TCTTCCCAAGGTTAGTTGAGTGG + Intronic
1046305836 8:112365793-112365815 TCCTCACAAATTGATGTGAATGG - Intronic
1055470659 9:76607432-76607454 TTCTCCAAACTTCAGGTGAATGG + Intergenic
1058846264 9:108962611-108962633 TCCTCCCTAGAGTAGGAGAAAGG + Intronic
1060758942 9:126232823-126232845 TCCTCCCAAGTTCAGGGCAAGGG + Intergenic
1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG + Exonic
1194347346 X:92782663-92782685 TCCATCCAAGTTTTGGTGAAAGG - Intergenic
1194420769 X:93670480-93670502 TCCTTCCAAGTCAAGGTGAAGGG + Intergenic
1194584342 X:95714717-95714739 TCCTCCTACGTTTAAGTCAATGG + Intergenic
1195305073 X:103574092-103574114 TCCTTCCAAGTTGAGGTGGTGGG - Intergenic
1196532242 X:116801881-116801903 TGTTCCCAATCTTAGGTGAAAGG + Intergenic
1198059735 X:133033130-133033152 CCCTCCCAAGTTTGGGTTAAAGG + Intronic
1200655670 Y:5899295-5899317 TCCATCCAAGTTTTGGTGAATGG - Intergenic