ID: 1075254124

View in Genome Browser
Species Human (GRCh38)
Location 10:120910903-120910925
Sequence GTTGACCCCATGATGGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075254124_1075254128 1 Left 1075254124 10:120910903-120910925 CCTAATCCCATCATGGGGTCAAC No data
Right 1075254128 10:120910927-120910949 TCAGCCTAATTACCTCCAAAAGG No data
1075254124_1075254131 15 Left 1075254124 10:120910903-120910925 CCTAATCCCATCATGGGGTCAAC No data
Right 1075254131 10:120910941-120910963 TCCAAAAGGCTGAACCCTCGAGG No data
1075254124_1075254133 16 Left 1075254124 10:120910903-120910925 CCTAATCCCATCATGGGGTCAAC No data
Right 1075254133 10:120910942-120910964 CCAAAAGGCTGAACCCTCGAGGG No data
1075254124_1075254134 19 Left 1075254124 10:120910903-120910925 CCTAATCCCATCATGGGGTCAAC No data
Right 1075254134 10:120910945-120910967 AAAGGCTGAACCCTCGAGGGAGG No data
1075254124_1075254137 30 Left 1075254124 10:120910903-120910925 CCTAATCCCATCATGGGGTCAAC No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075254124 Original CRISPR GTTGACCCCATGATGGGATT AGG (reversed) Intergenic
No off target data available for this crispr