ID: 1075254125

View in Genome Browser
Species Human (GRCh38)
Location 10:120910909-120910931
Sequence GCTGAGGTTGACCCCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075254125_1075254133 10 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254133 10:120910942-120910964 CCAAAAGGCTGAACCCTCGAGGG No data
1075254125_1075254131 9 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254131 10:120910941-120910963 TCCAAAAGGCTGAACCCTCGAGG No data
1075254125_1075254128 -5 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254128 10:120910927-120910949 TCAGCCTAATTACCTCCAAAAGG No data
1075254125_1075254137 24 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254125_1075254134 13 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254134 10:120910945-120910967 AAAGGCTGAACCCTCGAGGGAGG No data
1075254125_1075254138 27 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254138 10:120910959-120910981 CGAGGGAGGAGCCAAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075254125 Original CRISPR GCTGAGGTTGACCCCATGAT GGG (reversed) Intergenic
No off target data available for this crispr