ID: 1075254127

View in Genome Browser
Species Human (GRCh38)
Location 10:120910925-120910947
Sequence TTTTGGAGGTAATTAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075254127_1075254139 17 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254139 10:120910965-120910987 AGGAGCCAAGATGGCGGAATAGG No data
1075254127_1075254137 8 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254127_1075254134 -3 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254134 10:120910945-120910967 AAAGGCTGAACCCTCGAGGGAGG No data
1075254127_1075254138 11 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254138 10:120910959-120910981 CGAGGGAGGAGCCAAGATGGCGG No data
1075254127_1075254133 -6 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254133 10:120910942-120910964 CCAAAAGGCTGAACCCTCGAGGG No data
1075254127_1075254141 28 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254141 10:120910976-120910998 TGGCGGAATAGGAACAGCTCCGG No data
1075254127_1075254131 -7 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254131 10:120910941-120910963 TCCAAAAGGCTGAACCCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075254127 Original CRISPR TTTTGGAGGTAATTAGGCTG AGG (reversed) Intergenic
No off target data available for this crispr