ID: 1075254129

View in Genome Browser
Species Human (GRCh38)
Location 10:120910931-120910953
Sequence TCAGCCTTTTGGAGGTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075254129_1075254134 -9 Left 1075254129 10:120910931-120910953 CCTAATTACCTCCAAAAGGCTGA No data
Right 1075254134 10:120910945-120910967 AAAGGCTGAACCCTCGAGGGAGG No data
1075254129_1075254141 22 Left 1075254129 10:120910931-120910953 CCTAATTACCTCCAAAAGGCTGA No data
Right 1075254141 10:120910976-120910998 TGGCGGAATAGGAACAGCTCCGG No data
1075254129_1075254139 11 Left 1075254129 10:120910931-120910953 CCTAATTACCTCCAAAAGGCTGA No data
Right 1075254139 10:120910965-120910987 AGGAGCCAAGATGGCGGAATAGG No data
1075254129_1075254137 2 Left 1075254129 10:120910931-120910953 CCTAATTACCTCCAAAAGGCTGA No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254129_1075254138 5 Left 1075254129 10:120910931-120910953 CCTAATTACCTCCAAAAGGCTGA No data
Right 1075254138 10:120910959-120910981 CGAGGGAGGAGCCAAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075254129 Original CRISPR TCAGCCTTTTGGAGGTAATT AGG (reversed) Intergenic
No off target data available for this crispr