ID: 1075254137

View in Genome Browser
Species Human (GRCh38)
Location 10:120910956-120910978
Sequence CCTCGAGGGAGGAGCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075254126_1075254137 23 Left 1075254126 10:120910910-120910932 CCATCATGGGGTCAACCTCAGCC No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254127_1075254137 8 Left 1075254127 10:120910925-120910947 CCTCAGCCTAATTACCTCCAAAA No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254125_1075254137 24 Left 1075254125 10:120910909-120910931 CCCATCATGGGGTCAACCTCAGC No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254130_1075254137 -6 Left 1075254130 10:120910939-120910961 CCTCCAAAAGGCTGAACCCTCGA No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254132_1075254137 -9 Left 1075254132 10:120910942-120910964 CCAAAAGGCTGAACCCTCGAGGG No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254129_1075254137 2 Left 1075254129 10:120910931-120910953 CCTAATTACCTCCAAAAGGCTGA No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data
1075254124_1075254137 30 Left 1075254124 10:120910903-120910925 CCTAATCCCATCATGGGGTCAAC No data
Right 1075254137 10:120910956-120910978 CCTCGAGGGAGGAGCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075254137 Original CRISPR CCTCGAGGGAGGAGCCAAGA TGG Intergenic
No off target data available for this crispr