ID: 1075256611

View in Genome Browser
Species Human (GRCh38)
Location 10:120930567-120930589
Sequence GTTCCTGGTCCCAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075256611_1075256620 8 Left 1075256611 10:120930567-120930589 CCCAGGACCCTGGGACCAGGAAC No data
Right 1075256620 10:120930598-120930620 TCTTGCTGGAGATGGCCCTGAGG No data
1075256611_1075256616 -6 Left 1075256611 10:120930567-120930589 CCCAGGACCCTGGGACCAGGAAC No data
Right 1075256616 10:120930584-120930606 AGGAACCTGTTGCCTCTTGCTGG No data
1075256611_1075256621 16 Left 1075256611 10:120930567-120930589 CCCAGGACCCTGGGACCAGGAAC No data
Right 1075256621 10:120930606-120930628 GAGATGGCCCTGAGGACATCTGG No data
1075256611_1075256622 19 Left 1075256611 10:120930567-120930589 CCCAGGACCCTGGGACCAGGAAC No data
Right 1075256622 10:120930609-120930631 ATGGCCCTGAGGACATCTGGAGG No data
1075256611_1075256618 0 Left 1075256611 10:120930567-120930589 CCCAGGACCCTGGGACCAGGAAC No data
Right 1075256618 10:120930590-120930612 CTGTTGCCTCTTGCTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075256611 Original CRISPR GTTCCTGGTCCCAGGGTCCT GGG (reversed) Intergenic