ID: 1075259365

View in Genome Browser
Species Human (GRCh38)
Location 10:120949445-120949467
Sequence CTGCAGACACAGGGTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075259365_1075259374 25 Left 1075259365 10:120949445-120949467 CCTTGCACACCCTGTGTCTGCAG No data
Right 1075259374 10:120949493-120949515 CCCGCTGTCAGAAGGCAGCCAGG No data
1075259365_1075259371 17 Left 1075259365 10:120949445-120949467 CCTTGCACACCCTGTGTCTGCAG No data
Right 1075259371 10:120949485-120949507 AGGCCAAGCCCGCTGTCAGAAGG No data
1075259365_1075259370 -3 Left 1075259365 10:120949445-120949467 CCTTGCACACCCTGTGTCTGCAG No data
Right 1075259370 10:120949465-120949487 CAGAGGAGGCTGTAGTTCAGAGG No data
1075259365_1075259376 28 Left 1075259365 10:120949445-120949467 CCTTGCACACCCTGTGTCTGCAG No data
Right 1075259376 10:120949496-120949518 GCTGTCAGAAGGCAGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075259365 Original CRISPR CTGCAGACACAGGGTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr