ID: 1075259524

View in Genome Browser
Species Human (GRCh38)
Location 10:120950254-120950276
Sequence CTCCGGCTTGTCCCTCTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075259511_1075259524 18 Left 1075259511 10:120950213-120950235 CCAAGGCTGTGTCCCTGCTCGGT No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data
1075259508_1075259524 30 Left 1075259508 10:120950201-120950223 CCTGCGTGCGTCCCAAGGCTGTG No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data
1075259518_1075259524 -8 Left 1075259518 10:120950239-120950261 CCTGGCCCACCGGCCCTCCGGCT No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data
1075259509_1075259524 19 Left 1075259509 10:120950212-120950234 CCCAAGGCTGTGTCCCTGCTCGG No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data
1075259517_1075259524 -7 Left 1075259517 10:120950238-120950260 CCCTGGCCCACCGGCCCTCCGGC No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data
1075259514_1075259524 5 Left 1075259514 10:120950226-120950248 CCTGCTCGGTGTCCCTGGCCCAC No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data
1075259513_1075259524 6 Left 1075259513 10:120950225-120950247 CCCTGCTCGGTGTCCCTGGCCCA No data
Right 1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075259524 Original CRISPR CTCCGGCTTGTCCCTCTGCG CGG Intergenic
No off target data available for this crispr