ID: 1075260946

View in Genome Browser
Species Human (GRCh38)
Location 10:120963484-120963506
Sequence GCAGCCTTCTGACCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075260946_1075260955 1 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260955 10:120963508-120963530 GGCTGCAGGTGTGTTTCCAGGGG No data
1075260946_1075260953 -1 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260953 10:120963506-120963528 CGGGCTGCAGGTGTGTTTCCAGG No data
1075260946_1075260956 12 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260956 10:120963519-120963541 TGTTTCCAGGGGCACCTGACAGG No data
1075260946_1075260961 23 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260961 10:120963530-120963552 GCACCTGACAGGGCAGGGACCGG No data
1075260946_1075260957 13 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260957 10:120963520-120963542 GTTTCCAGGGGCACCTGACAGGG No data
1075260946_1075260959 17 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260959 10:120963524-120963546 CCAGGGGCACCTGACAGGGCAGG No data
1075260946_1075260960 18 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260960 10:120963525-120963547 CAGGGGCACCTGACAGGGCAGGG No data
1075260946_1075260954 0 Left 1075260946 10:120963484-120963506 CCCAGCCCAGGTCAGAAGGCTGC No data
Right 1075260954 10:120963507-120963529 GGGCTGCAGGTGTGTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075260946 Original CRISPR GCAGCCTTCTGACCTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr