ID: 1075265058

View in Genome Browser
Species Human (GRCh38)
Location 10:120993388-120993410
Sequence ATTTACATGCAAAATGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075265057_1075265058 12 Left 1075265057 10:120993353-120993375 CCATTATAACATGCAATTGAAAC No data
Right 1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075265058 Original CRISPR ATTTACATGCAAAATGTGCA AGG Intergenic
No off target data available for this crispr