ID: 1075266828

View in Genome Browser
Species Human (GRCh38)
Location 10:121007621-121007643
Sequence TAGCCTCCTTACCCCCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075266828_1075266832 5 Left 1075266828 10:121007621-121007643 CCATGGTGGGGGTAAGGAGGCTA No data
Right 1075266832 10:121007649-121007671 GATCCACAGCCTGAGCAAGCAGG No data
1075266828_1075266834 12 Left 1075266828 10:121007621-121007643 CCATGGTGGGGGTAAGGAGGCTA No data
Right 1075266834 10:121007656-121007678 AGCCTGAGCAAGCAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075266828 Original CRISPR TAGCCTCCTTACCCCCACCA TGG (reversed) Intergenic
No off target data available for this crispr