ID: 1075269838

View in Genome Browser
Species Human (GRCh38)
Location 10:121039073-121039095
Sequence TAGAGGGATAAATCCATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075269838_1075269845 29 Left 1075269838 10:121039073-121039095 CCAGACATGGATTTATCCCTCTA No data
Right 1075269845 10:121039125-121039147 TTCCATTCATGCCACCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075269838 Original CRISPR TAGAGGGATAAATCCATGTC TGG (reversed) Intergenic
No off target data available for this crispr