ID: 1075272227

View in Genome Browser
Species Human (GRCh38)
Location 10:121062246-121062268
Sequence TATCATAAGGGGCAGCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075272223_1075272227 12 Left 1075272223 10:121062211-121062233 CCAATGCAAGGTGTTTGTAGTCA No data
Right 1075272227 10:121062246-121062268 TATCATAAGGGGCAGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075272227 Original CRISPR TATCATAAGGGGCAGCAAAG TGG Intergenic
No off target data available for this crispr