ID: 1075275443

View in Genome Browser
Species Human (GRCh38)
Location 10:121088971-121088993
Sequence ATTGAGATGCAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075275438_1075275443 -2 Left 1075275438 10:121088950-121088972 CCCACTTTAGATAAGAAGAAAAT No data
Right 1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG No data
1075275436_1075275443 0 Left 1075275436 10:121088948-121088970 CCCCCACTTTAGATAAGAAGAAA No data
Right 1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG No data
1075275439_1075275443 -3 Left 1075275439 10:121088951-121088973 CCACTTTAGATAAGAAGAAAATT No data
Right 1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG No data
1075275437_1075275443 -1 Left 1075275437 10:121088949-121088971 CCCCACTTTAGATAAGAAGAAAA No data
Right 1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG No data
1075275435_1075275443 13 Left 1075275435 10:121088935-121088957 CCTTTTATTATTTCCCCCACTTT No data
Right 1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075275443 Original CRISPR ATTGAGATGCAGAGGGTGGA TGG Intergenic
No off target data available for this crispr