ID: 1075277693

View in Genome Browser
Species Human (GRCh38)
Location 10:121109533-121109555
Sequence TCTGCTGTTGGGAGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075277693_1075277700 6 Left 1075277693 10:121109533-121109555 CCCCCTGTGCTCCCAACAGCAGA No data
Right 1075277700 10:121109562-121109584 ATAATTCACAGTTATGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075277693 Original CRISPR TCTGCTGTTGGGAGCACAGG GGG (reversed) Intergenic
No off target data available for this crispr