ID: 1075281021

View in Genome Browser
Species Human (GRCh38)
Location 10:121138507-121138529
Sequence ATTTCTCTGCTGATGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075281021_1075281027 -7 Left 1075281021 10:121138507-121138529 CCAAACACCATCAGCAGAGAAAT No data
Right 1075281027 10:121138523-121138545 GAGAAATCATTAAGGAGTGGGGG No data
1075281021_1075281024 -10 Left 1075281021 10:121138507-121138529 CCAAACACCATCAGCAGAGAAAT No data
Right 1075281024 10:121138520-121138542 GCAGAGAAATCATTAAGGAGTGG No data
1075281021_1075281026 -8 Left 1075281021 10:121138507-121138529 CCAAACACCATCAGCAGAGAAAT No data
Right 1075281026 10:121138522-121138544 AGAGAAATCATTAAGGAGTGGGG No data
1075281021_1075281025 -9 Left 1075281021 10:121138507-121138529 CCAAACACCATCAGCAGAGAAAT No data
Right 1075281025 10:121138521-121138543 CAGAGAAATCATTAAGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075281021 Original CRISPR ATTTCTCTGCTGATGGTGTT TGG (reversed) Intergenic
No off target data available for this crispr