ID: 1075282427

View in Genome Browser
Species Human (GRCh38)
Location 10:121151271-121151293
Sequence AAATTGAAACAGATCAATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075282427_1075282429 7 Left 1075282427 10:121151271-121151293 CCACTATTGATCTGTTTCAATTT No data
Right 1075282429 10:121151301-121151323 CTTCATGATTTAGTCTTGGTAGG 0: 17
1: 103
2: 687
3: 6544
4: 4803
1075282427_1075282428 3 Left 1075282427 10:121151271-121151293 CCACTATTGATCTGTTTCAATTT No data
Right 1075282428 10:121151297-121151319 ATTTCTTCATGATTTAGTCTTGG 0: 19
1: 141
2: 1120
3: 10705
4: 6959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075282427 Original CRISPR AAATTGAAACAGATCAATAG TGG (reversed) Intergenic
No off target data available for this crispr