ID: 1075285970

View in Genome Browser
Species Human (GRCh38)
Location 10:121186301-121186323
Sequence CATGACCTGTCCAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075285967_1075285970 17 Left 1075285967 10:121186261-121186283 CCATACATATGATTTGAATTACA No data
Right 1075285970 10:121186301-121186323 CATGACCTGTCCAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075285970 Original CRISPR CATGACCTGTCCAAGCTGGA AGG Intergenic
No off target data available for this crispr