ID: 1075287231

View in Genome Browser
Species Human (GRCh38)
Location 10:121197421-121197443
Sequence CTCTGAAAGTCATACATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075287227_1075287231 17 Left 1075287227 10:121197381-121197403 CCTCAGATATTTTTGCCAAAATG No data
Right 1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG No data
1075287228_1075287231 2 Left 1075287228 10:121197396-121197418 CCAAAATGATCTTCATTACCTAT No data
Right 1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075287231 Original CRISPR CTCTGAAAGTCATACATGAA GGG Intergenic
No off target data available for this crispr