ID: 1075290198

View in Genome Browser
Species Human (GRCh38)
Location 10:121222827-121222849
Sequence GTGGTAAACTGACCAAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075290198_1075290199 -10 Left 1075290198 10:121222827-121222849 CCTGGTTTTGGTCAGTTTACCAC No data
Right 1075290199 10:121222840-121222862 AGTTTACCACCCTAGAGACTTGG No data
1075290198_1075290204 8 Left 1075290198 10:121222827-121222849 CCTGGTTTTGGTCAGTTTACCAC No data
Right 1075290204 10:121222858-121222880 CTTGGGCACATAATTTAACATGG No data
1075290198_1075290200 -9 Left 1075290198 10:121222827-121222849 CCTGGTTTTGGTCAGTTTACCAC No data
Right 1075290200 10:121222841-121222863 GTTTACCACCCTAGAGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075290198 Original CRISPR GTGGTAAACTGACCAAAACC AGG (reversed) Intergenic
No off target data available for this crispr