ID: 1075290443

View in Genome Browser
Species Human (GRCh38)
Location 10:121225481-121225503
Sequence GCAGCTAGTGAGTTTTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075290441_1075290443 -1 Left 1075290441 10:121225459-121225481 CCTATAAATGAATCAAACTCCTG No data
Right 1075290443 10:121225481-121225503 GCAGCTAGTGAGTTTTATTTTGG No data
1075290439_1075290443 28 Left 1075290439 10:121225430-121225452 CCACATAGCTGCAAAGCTGAATG No data
Right 1075290443 10:121225481-121225503 GCAGCTAGTGAGTTTTATTTTGG No data
1075290440_1075290443 5 Left 1075290440 10:121225453-121225475 CCACTGCCTATAAATGAATCAAA No data
Right 1075290443 10:121225481-121225503 GCAGCTAGTGAGTTTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075290443 Original CRISPR GCAGCTAGTGAGTTTTATTT TGG Intergenic
No off target data available for this crispr