ID: 1075292390

View in Genome Browser
Species Human (GRCh38)
Location 10:121241592-121241614
Sequence CTGAAGAAGGAGCAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075292386_1075292390 18 Left 1075292386 10:121241551-121241573 CCACAAGGGACCTGTGAATGGGT No data
Right 1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG No data
1075292383_1075292390 29 Left 1075292383 10:121241540-121241562 CCTGCATTCTACCACAAGGGACC No data
Right 1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG No data
1075292387_1075292390 8 Left 1075292387 10:121241561-121241583 CCTGTGAATGGGTCTGTCACAAT No data
Right 1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075292390 Original CRISPR CTGAAGAAGGAGCAGCAGGC AGG Intergenic
No off target data available for this crispr